SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10133  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA005642
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_cytokine_receptor_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.509
 

Sequence

CDS
ATGAAATATGAAATCAGGATCTACATCAAATCTAAAGCTGCAGTGAAAGAAGTGTTTTGGTCAGACTTCACATATACCATGGTATATACACTTAGCGAGAGACCTAGAAGACCACCAGACACCGCAGTTGGAGCCTTTGATCAATCTTTATATCAAACAAATAGAATGATATACATTTATTGGAAACAACTTGAAGAATATGAAGAGGCAGGTACAAATTTCACTTACAAAGTTGTAGTTCATCATAAAAGCAATTATGAAACTTTGACAGCTGACAACAACAAAAGTTTGAGTTTTGTGGTCTTGGAAAAAGCACCATTTGATGCAATGGATGTCTACATTTGGTCTAGAAATGATAATGGATCTTCCATTAACAGCAGCCATCTGTACATTCCACCCAAAGAAGATACTGAAGCATTAAAAGTTTCTTCATTTACCAAACTAGCTTATGAAAATGGTGCATATAAATTGTCCTGGGTTGGTATAGAACATATTGACAATTATACACTTTTCTGGTGTCAACATAATAGTACAAAAATTTGTGCAGGCCGAATGAACTTCATTGTTTTAAGTGCCAATAAAACAATGCAAGTCATAGAACTACCTAGAGAAAACAGGTATCAGTTTGCCATATCGGCTAATAATGGGACGAAAACTAGTGGCATGGTATGGGCTATCTGTGATATATCTAAAGATGCAATTCCAATGTATGGTTTTCCGGTCAAAATGGACCATGGTATTCCAGGGAAAACTTTTGTAAAGATTAAATGGGCAATGACTTGTACACTTCAAGAAGGAATCATTACAGGATATTTGATCGCATATTGTCCTGCTCTAGATACCACTAATGTTTGTGCAACAAAAAATAAAACTAACTTATACATATCTAATCCTAAGCAAATGGAGATCAACATTACAAATCTTGAACCATACACTACATATATATTTACACTGGCATTGAACACCACTTATGGATTTAAAACAGTAGAAAATGCTTTCACGAGTATGACTACAACTGAAGATACTCCAACTAGTCCAGTTAATATTAATATAACCGATGTGCTTAGTGATTCATTGACGATTTCATGGGACCCACCTATTCATAAAAACGGAGTTATTGGAAAATATGTCATAAATAACTATGGTCAAGAAGTTTATGTAGAAAAAGTTTCAGATAAAGATGAAGATTCAAAAAGAAGGCATATTCGTTTGACTGGCTTACAGGGGTTTACTAATTATTCATTGAGTGTACAAGCATGTAGTACAGCTATAAGCAGTTGTTCGGTTTTGAATCCACATGATGCCCTTTTTGTCAGGACGAGAATAGGTCCTCCTAGTGGAGTTGCCGGACAAACTTACCAAGTTAGAGCTGTTAATTTTGATGAAGATCCTTACCACGGTGCTTTAACTGACAATAAGGATGTATACCTACATAATGCTAACTATAAAGGTATACTAGAATATCCTGGAGAATGGAGTGAGCCAAGTTTTGTAAATTGTACAAGCAAAGAACATGTGACACTAACTCTTATTTTAATGGGAATATTTATGATAATTGGTATTATGTATGGTTTTATTAAATGTTACAAGAAATACCGAAAAATGGAAGATATTAAACCAGTTTTACCAAGTGGACTAGGAGTCCCCGAAAAGGATATTTCGAAATATGCTATTGGTGGTTGGAATCCTACAAACAAGGATGAGAAACCATCTTCAGACGAAATGTTGCTATTACCAAATAGTAGAACCACTGTATCTTCAGAATTGAAACAGAAAGAAAACAATAACAGTGCTTCTAGTGATCACACTGATAGTACAGCTTTATCAGATACATCACATGGGCCTGTAGAAAGACAAATCTCCTCATCTGATGATGGATCTAATTCATCACTACATCTTGAAGTAGAACCTACGAGAACAGCTGACAGTAACATCGATGGCGAATCATGCAATTCCGAAACTGAAACATCACAAATACCGTCACCATTCTTTAATGATAATACTTTCAAGAAAAATCCATGTGGCTATGTGCAACAATCTGTAGTGAGTCCTAATACAGGATATGTTCAAAGTGTTCAAGCAGGCGTTACAAACCCACCACAACCCTCATCACTCAGTGCCAGCTCTAGTTATGTAATGGCAGCTCTGTCTCCACCTATATTTACGACACGTGTTGCTCAACCTTGCGTAACGAGTTCACAATCAGCAGGAGGCTATGTGCACCCTGAAGGTGCTCAAACTATATCAGCAATGAATTTCCCGAAATTGGGGCAGACAACGAACAAACTGTTTGGTCCTGAAAGCTTGCCAACAATGCAAACCTTGCCACCAGCGAAACACACTGCAGACAGCAGCTACATTCAACTGCAATCTCTAGATTCCTTGCCCAGACACAAACATCCTGCCCGAAGTACAGTGCCATTAAAGACGCCAGCGTCTACCGGCTACGTCCGCCAAGGTATTTACAAAATTAATCTTGTGCCAAGCGACTTGAGCACTGAAGAAGCCATCCTTCAGATTGCTGACACTATTGATAATCTCAATGGGATAGTGGAAGACGTGTTCTCTCGCTTAACGCGGCGAATCAAGCAGAATGTAGATAAAACCGCAAAATTGAATGAACGCATCGAAAACTCTAGGCTTAAAGTTGAAAAACTGACTGGAATGCAGAGAGCCATCAAAGTGTTCTCGAGTGCAAAGTACCCGTCGTCAATAACGCACGAGCATTATCGATCCGTCTTTGATTTGGAAGGCTATCAACATGTGCCTAAAAATGTTAAACTGAGTGCTAAAACTCGGGGGCCATCTGATGATAAAAGAATACAGGAGAAGCTACACTTCTATCATGTTAAAGTTGCGGAACCTAATTCACTCAAGCCCGATGAAGATTTTAGTTTGAACGCTGTTATTGATAACCTGGAAACCATCGGTGAACTTTTAGTATTTAACACCGATGAAAGCCCTTACTTCGGTGTTACCTCTAAAACACCAACCTACAAACCGGTCATCAAGAAATCGAATATTGAAAATAAGAGTCTAATAGAAGCGGCACCTTCGTCTATAATGAAGAAAGACGTCTTGAAGCGCGAAGTAGACGAATACATGTACGCACCTGGGATGGGAATGGTACCCGAAATGGAGATGCCGTTGGATTTACCGCATCTTCCAGGAATCGCTGAGGACATACAATATACTATCGCGACTGAAGGGTCTATAGCCCCGTCTGTCGTGACGTCACCGGTCACGCCGATCATCGCCATTCCTGAGGTGGAATTACCAGAGTTGCCCGATCTAAAGGAACTACCTGACGTGAAACCAGAGCCCGTGGCTATACCAGATATACCGGACGCTCCTCCGTCACCGGTTCCTGTTAGTGTGCAAGCGTTGCCACCACCGCCGCCCCCGCCACCGCCTCCGCCCCCGCCGCCGCCTATGAAGGAAGTAGAGCTCACACCATCAAAACGTGAAGAGAAAGTTTCGCCGCTATCTCCTCCCGGCACTGGTGATGCTCACGCGGACCTCATGGCTGCGATCAGGAGCGCGGGCGGTGCTGGGAGAGCGAAGTTACGGCACGCGGTCGATTCTGAAGCACCCGAGTCCACCAAACCCGCGTCCACCGGTGACCTGATGGCTGACCTCCACGCGAAACTGTCGATGCGTCGTCGCGGCATCTCTGGCGCTGAACGCGCAGGCGGCTCCGTACTCCACACCCTCGCCAGTATAATACCGGAGCCCGGAGACCAGTCGTCACCGCAACATTCCTCCGGCGACGAAGACTGGGATTAA
Protein
MKYEIRIYIKSKAAVKEVFWSDFTYTMVYTLSERPRRPPDTAVGAFDQSLYQTNRMIYIYWKQLEEYEEAGTNFTYKVVVHHKSNYETLTADNNKSLSFVVLEKAPFDAMDVYIWSRNDNGSSINSSHLYIPPKEDTEALKVSSFTKLAYENGAYKLSWVGIEHIDNYTLFWCQHNSTKICAGRMNFIVLSANKTMQVIELPRENRYQFAISANNGTKTSGMVWAICDISKDAIPMYGFPVKMDHGIPGKTFVKIKWAMTCTLQEGIITGYLIAYCPALDTTNVCATKNKTNLYISNPKQMEINITNLEPYTTYIFTLALNTTYGFKTVENAFTSMTTTEDTPTSPVNINITDVLSDSLTISWDPPIHKNGVIGKYVINNYGQEVYVEKVSDKDEDSKRRHIRLTGLQGFTNYSLSVQACSTAISSCSVLNPHDALFVRTRIGPPSGVAGQTYQVRAVNFDEDPYHGALTDNKDVYLHNANYKGILEYPGEWSEPSFVNCTSKEHVTLTLILMGIFMIIGIMYGFIKCYKKYRKMEDIKPVLPSGLGVPEKDISKYAIGGWNPTNKDEKPSSDEMLLLPNSRTTVSSELKQKENNNSASSDHTDSTALSDTSHGPVERQISSSDDGSNSSLHLEVEPTRTADSNIDGESCNSETETSQIPSPFFNDNTFKKNPCGYVQQSVVSPNTGYVQSVQAGVTNPPQPSSLSASSSYVMAALSPPIFTTRVAQPCVTSSQSAGGYVHPEGAQTISAMNFPKLGQTTNKLFGPESLPTMQTLPPAKHTADSSYIQLQSLDSLPRHKHPARSTVPLKTPASTGYVRQGIYKINLVPSDLSTEEAILQIADTIDNLNGIVEDVFSRLTRRIKQNVDKTAKLNERIENSRLKVEKLTGMQRAIKVFSSAKYPSSITHEHYRSVFDLEGYQHVPKNVKLSAKTRGPSDDKRIQEKLHFYHVKVAEPNSLKPDEDFSLNAVIDNLETIGELLVFNTDESPYFGVTSKTPTYKPVIKKSNIENKSLIEAAPSSIMKKDVLKREVDEYMYAPGMGMVPEMEMPLDLPHLPGIAEDIQYTIATEGSIAPSVVTSPVTPIIAIPEVELPELPDLKELPDVKPEPVAIPDIPDAPPSPVPVSVQALPPPPPPPPPPPPPPPMKEVELTPSKREEKVSPLSPPGTGDAHADLMAAIRSAGGAGRAKLRHAVDSEAPESTKPASTGDLMADLHAKLSMRRRGISGAERAGGSVLHTLASIIPEPGDQSSPQHSSGDEDWD

Summary

Pfam
PF00041   fn3
Interpro
IPR003961   FN3_dom        + More
IPR036116   FN3_sf       
IPR013783   Ig-like_fold       
SUPFAM
SSF49265   SSF49265       
Gene 3D
PDB
6IAA     E-value=0.00850508,     Score=97

Ontologies

Topology

Length:
1261
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
23.7372899999999
Exp number, first 60 AAs:
0.01526
Total prob of N-in:
0.73613
inside
1  -  505
TMhelix
506  -  525
outside
526  -  1261
 
 

Population Genetic Test Statistics

Pi
196.426405
Theta
16.281278
Tajima's D
-0.896915
CLR
113.123051
CSRT
0.155392230388481
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26280517 APAPVYTFSDDEEETKR 100.00 0.002
26280517 YVGCADGGEAIPATER 100.00 0.006
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号