SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10131
Pre Gene Modal
BGIBMGA005561
Annotation
PREDICTED:_uncharacterized_protein_LOC101742325_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.231
 

Sequence

CDS
ATGCAGAACATTGCCAACAACAATGCCGCCGCTTATATCGTGAGCGAGAACGAGGAGAGAAACAGGATCAGCCGCGAGTCCGTGGTGGAGTTCGAGCCGCTCCCCACAGAGCTGAGGGTCGCCGATCCCCTGGAGCGATGCGCGGACTGGTTCAGCGGGGAGGATTTCCCGAGGAATCAACTGCAGTACCTTCGGGAGATAGGACGTGGATGGTTCGGCAGAGTGGTGGAAGGTGAGGTCGATGACGCTGGTCCAACGAAAGCAGTGGCCGTGAAGATACTCAACCCGAATGCTAATCTAGAAGACAAGGCCAGGTTCTTAGACGAAGCCAAGTTGTACCGGGATTCGCGACACGATACCATCCTCGGCTACGTCGCTAGGTGTCTGCAGGAAGACCCATGGATTGTCATATTCGAATTGTGCAGTACGGATCTCCATCAATACCTAACAGTGAACAGACCGAAGATGGCGATACTGAACGAGAGCGGGGTTCCGTTGCGGTTGATGTGTGACGTCACTTCCGGACTCTCCTATCTCAATTCCAGGGGACATTTATACGGGAATCTATGGAGCGGTAACGTGCTAGTACGCGGCGAGGCGGACAACGCGCGGGCCGTGCTGGGACGGTACACGAATGCCGAATCTCCGTACGAACACGACGCTCCCGAGACGAGGAGACACCCGCCTCTGTACACGGCCAGCAGTGAAGTATGGTTCCTAGGAAATCTGATATGGGAGGTCTGCGCCTGGGGAGCAACACCCGTCGCTCTACCGCCGCCGCTACCCGACCTTCCCTGCCCGTACAGAAATCATCTATATCAAGTGATGCAGCTGTGCTGGAACACCAATCCGGATGCTCGTCCTACTTCCGCCCAGGTTCACGGTCTCATCGATCACTTGTACACAAGTCACACGGAGACTACAGAGTTGTCGCAAGACGGGAGCTTCGGGACCAGCGACTTCGAGGAACGCTGGCAACGACTCAAACCCAACACGATACCGAAGATAGACGAGCACGTCGCCATCGTGCACGCCCCCTCCACCTCCGTCGCATCGCACTTCACCGGCTCCGACCGCGAGCTCGATGACGCGCACACCGCACACGACACGCTCAGCATCGACATGGACACCGCCGTCTCCAGATCCAGCAGTATCATGTCGGACAAGGATCCCCTGTCCGTACAGATCAAGTCCGAGAGTCTCACCAACCTCCACGGATCGCTGGAAGACGTCAGGAACATCTACCTCACGCACAACGAGATGGCCGCCCTCGAATGCCATCAAGGAAATATGCAACTCGACGAAGGGAGAGAAAAAGAAAACGATAAATCCGATAGTTCAGTTGATCCCTGGGTGAAGGACATCATGGCGGGGAGCCAGGACGACGTCAGCTACTTTAAAGACGTCAGCGACGTCATTAAGAATCTCGATAATATGCTGAATTCTGAAAAAACTTCAAGCTCTGAATCCAGTCATCAGGCTAGTCCTTCAAGGGACAATTTGAGTTTGGACTGTAAAAAAGAGTATCCGGTACAGTCTAGTTTAGTCAAATCACCCGGTATCAATAATTTCCAGAACATTCTAGACGCTGGTTTCGATACTAATCAAGACGAGACAGAAGACGAAGATGTCGACCGTGATACAATCGGGACGTTGAGTCACTCATTCGAAAGGCACAGCGACACGATCAGTCAACAAACGTTAGAAAATCTCACTCCAGAAACACCTATAAAAGATTTAGTTGGTACTGGAATTTCTGGACTAAATGTTCCTCTTGATCTTGATGAAGTAGCGCACGACGAGGTAGATGTGCGAAATGTATTGCCAAATGATAAAGTAGCTAATAGTGATAGTGAGATACCTAAATTGAAGGAATTGTGCGCGTCCTCTATATCTAGTGTAAGTGAAAATATACAGCATGTTAGAAGTGAAGACTGCCAGTTTAAGTGTGATAGTAATGTAAACAAAGAAATTGATGTTAAGGAAGGAACTAAGTCATTAGATGATAACCTACTATCTAGTGAGGAGGCTGGAGAGTTTATTGAAGAGAAAAATGATATTATATTAGACAGTGTAGATAAAAATGTCTTGCCTAATTTACATACAAATAATAAACATGAACTTATATGTGAAAATTCAGGGCTTGAAAGAGAAGACTCAAAAAATGAATCAAGCAGTAGTTATAATAAACAAAACGTAGAATTTAGTGATCTCATTGAAAACGTAATTGATAATTTAGTAGAGTCACATGTTGTTAAAAGTGATCCTAACAAAATAGATATAGTTAATAATGTAGTAAAATTTAACGATTTAGAAGAAATAAAACTTTGTGAAAGTTCACTTGAACCGCAAAGTGAAGGAGAAAATGTGTGCAACAAAACATCCGATACTATACACTTTACAGTCGATAGTGAAAGTGTAAAAAAAGAATTTAACGCTCTTGATACGCACGAGGATACGGAAACATCAAATATTTCATTTCTAAAATTTGGTGAAAAACCAATTTCAACAGAAGATCTACCCAAAATAAAAATGAATCTTCCGAAAATTAAAGTAAATAAAATAAAATGCATAGAAAATAATATAGAAGAAGTACCTATAGATTTGAATAACATTGAACAATTTCCAACTTCTGAAACATCAAGTCAAGTTATTCTGCTCTTAGAGTCGAATAAACAAAATCACGAAAAGAGTACAGATACATCAAATGAACAAATTCATATAGTTGAGGACATAAATAACGATGGAAATGTTCATAGTGAAGAAATATATAGTAAAACGTTACAAAATAATGTACAAGCAACATTAGATTTTATTGAGGCTGAATCTATCAAGGAAATTGATTTGAAATCATCTGAAAGGGGTACAGCAAAAGAAACATGCTCCACGAATGAATCAGGTTTAAATGATTTAGAAATAACACAATCTTCACCCACAGCTACGAACGACCGAGTACAAAATATCGAAAATGATTATGAAATGAATAATAAGACTGAAACGAAAGATCTTACTTTAGAAAATACACTGAATTATTTAGACGCAGAACGTACACAAGAACATAAAATATCATCAGAAAATACAATATACTCTTTTGAAAAGATAGATTTAGAAAATGTAGAAGTGACAAAACTACCTATGGACATTGAAAATTCGTGTGACAGTAATGTTTGCATTGAAGGAGTTCCTAAGGAAATTGATCATGCTACAGCACTCTACTCAACTGTTCTCTCCCCCGAACAGACACCTAGTACAGTACAAAATAATGTAAATATAGAATCCGATAAGGCAAGCACATTTAGTGAAAATCCCATTATTCATTCAGACATTAAATCTGAAATTTTTAATAATAGTCAATCGTCTTTTTTGCCACCTGAAGAAGTACAAAATAGTGATAAGATTTTTAAATGCGAATTAGATGGAAATACAACAAAAAACGATACGATAGACACGTCTAGATCTGATTATGTGATATATGATTTGAAAGAACAGTCAAATGACAGCACTGTCTATTTGGATCTCGTCGAAAACTCTGGTGAGTTGAAACAAACTACTAAACTGAACAAAGACGTTGGAACAATGCCTTTGTGCTTAGATTCATCAGGCTTACAAGATATTTCTCTCTTGAAAAATGAATCTACAGTTTATCTGGATCTACCTACCGTCAAAGTAGCTAAGGAAATTGATAATTTCCTCCACATGGAGAGACTTAACGCTGAGAGCTGTTTTAAAACAGGTTTGGTCTCGAGTACACCTCTAGGAAGCGATAATTCTGTAGATTTTGCCGATAACACGAACAATAAAGATGAAGAAATAAAAAATATTTTATCAGAAACAAAAGTTCCTGATTACGGTCCTGGTGTGACACTGACTAAGTTGGAACAAACGTTTGTCCCGGAAAGCCTAAGTCCTTTCGAGTCGCCCACGAAAAGTCACCCCACTGACACTTTTGACGAAAACAGTTCAGTAGTGTTGGGGCCGTTTGAAAACTGTTCTCTTGAAATATACAAAGGCATCAAATCGGAGTTGGTAGATTTACCAAAAGAGGAATTGTTGGCGTTTTCATCCAACTTCAGCGAAATGAATCTTGAAACTCCATCGCCGTTACGCGACGTTAATTTCCTGAACGAAGTACCGGATATATGTCAGGACGAGTTCTACGATATCACGTCCAGCGAGTCGAAATCGAAAGTTGAACCTGATGTTAATGAAAACGAACCGAAAATTAGTATTTCGGACCCGCAGACCGAAACGAACACCGAAGATAGCGGGCATTCTGTGACCGAAAAGCATGTCTCGCCATCTACGCCTCCCAATTCACCCGGAGTGTTCCTTGCCTCGACATCGCATCACAAGTATTTAGTTAATATCGACTTGGACGTGCCTAAAGAGGTTCCACAATCGACAGAGCAAGTCGACGCCGTTCAGAACGAAATCGATTTAAATCAAATAGAATTACAAATAACTTCGAAGTTGGCGATGGCCGAAAACGAGAATAATATGAACATTGAATATTCTGGGCCTTTGACGGTTGAAGGTCTTGAAGACGATGTACTCGAGGAATCGATTTTAGCTGGAAACGGAGGGTCTGTAGAGGATCTGCGAGAGGACCTAACGTTAGACGAAGAGTGTGTGAAGGCCCTTAGGAATGAACTCGAATTGAAATTGCCTCTAGCTCAGGTGGCGGCCATAGAGCCGCAGTGCGAGGCGGAGCGCGGCGAGTGGACGGCGCAGCTGCCGGCGCCGCCCGAGCTCGTGCTGTCCTACCCGGGCGCGCTCAGCCCCATCGCCGAGGAGACCGGCCAGCAGCTCTGCGCCTACGAGAACGACGCCAACTGGAACGCTTCTCTCCTAACGGAATCGTCGGAAAGCTACCCGGAGCCCTGCAACAACTGGACCGAGCAGAGCACGCAGCCGCCCTCCCCCGCACCCTCCCCGGCCCCCTCCCCCGTGCCCTCCCCCGCCACGTACTCGCTGCACACTCACAACCACACCTACACACTGCACAAAGACGCGCCCACCGCCGAGGTGACGATGAGCGCCGATAGCTTAAACGCTAGTCCGTGTAAAGGAACGAAACCAGATGTGCACTCCCCCGTCGACGACAGGACGTACACTAAGAACGACGAGAAGGAATCGAGCTGCGAGCGGATCTCGCAAGTGTCGCCCTTCCTCGTGAGCCCGACCACCGACACCTCCGACAACCTCGACAACCCGACCGGCGTCTCCACCCTGTCCAAGACCACGCTGCCCACCGACGCCAAGCTGTCCAAGCAGCCCTCCGAGTGCCTCTCCAAAGCGACGAGCATCGACTCGTGGTGCTCCAACGACACGCTTTACAACGTCGAAGAGAATTTCGACGACCTCGCGATGGACCCCGAGCCGACCAAGGGAGACGGCAACAGCGAGAGCACCGACACGCTCACCCACGACGAGGACGACCGCGAGCTCAGTCACTGCTCCACATACATCATCCACGACAGCAAGTCCGAAGCCTGCGAGACGTTCTCGCCGGACTCCATAGCGGCCTACGACCAGTACACGTACACGAAGGTGAGGTCTGCCGCAACCGCCGCCTCGTCCTCGCAGCTAAACGACTCCACGAAGAACAGCCCCACCAAAGACCTGGCGTACGGCACCCTCATGTCGGGCATGCCGTCCTACTCCAACTGCACCACTGAAGTGGCATCCATGGACGATCCGTGGAAGTTTCAGCAACCGGAGCTGGTGAGGAGGTCTCCTCTCGGGGAAGACCCCGATCTCACCCCGCCAAAGTTATCGGAGGATAAGGAAATCGAAAACACCAGTCCTCGTATCTTTTCAGAACCGTGCATTAAAAAAATGGAAAGTGTTGAAATAAGTTGCCTCGAAGACAATTTCTCTGAGAGTAAAAACAAATCAAGCAGCCCTGAGAACGAAGCCCTGCTGATAGACATAGGTGACAGCCCTAATGTCAATTACAGGAACAACATGGCGCCCTCTATCACCAGCACTCCGCTCACAGAAATCGTGGGCGACGAGGATGATGTGCAAGCCATACCGATGACGTTTCCGGATGATAAAACGGTCAACTCCGAGTACGTTATGTCTGTACCGACTTTTCAAAATTTTCAACAATCCGCCGAGATCAGACCGCAGGATTTGTCTTCCAACACCGATCGAGGCACCCAGGACACGGAGATACTCCTTGAAGGCGACAGCAAAACCCTGAGCAGGTACAGCAACCGGGACAGCTTGGTCGTGTCCGAGCGAACGCCGACGTATTCCGACTTTGAAAATTCGGCGACAACAAAACCTCAAGAAGTGAATTCTCGAGATAAATCTAGTCAAAGCATGGAGAGCGGAGTTAGTTCTGAGGAATTTCGTCAATTCGAAAACTCTGTAAAGCACCGTCCACAGGATCTGTCGTCGCTGATAGACGCCAGCTCGCTGTTCTTGAGGAGTGAGAGGCTGCTGGCGAGCGAGCTGGTGGTCGCCCCCCACTCGCCCCAACCAACAGACGAGCCCACGGCCCCCACGACCCCCACGACCCCCACGACTGGTCCTCTTAAACTAACGAATTTAACAGAATCTCACATATTAGTCGACGTAAGAGAACCGACCAGTACCTACTTGATAAATTTTGATTTGGAAGACGAAACGGAACAGCCTCACTCGATAATAGTAACGGAGGCCCCTTTAGATCTGTTCAAAGAAAACTCGAACGTTACCTTTGATTCGCACACAGAGAAACTCATAGATCTGAACCACACTTATGATTCTCACACAAATCGACCTGAACTTAGGAATAGCATTGAGGAGGCTCACTCGGAGTCGAACGGGGACTCACAGCCTGAAGGTCCCCACAGTATTATTGATTACGAAACAATGCAAAAAGGCAGCCCGAGTCAAATAGAAACGTCTGATGCGATATCGAATATAAAGAGTACACCAAACGGCTCCATCAGCGTCGACGGTGTAAACGGAAAAAACGAGAACTACGCTACTGTGCATTTTTTAAACGAAACCTTCGAGGAACTGATCGAGAGTAACGTGGACGACAACGACAGAGACGCGAGAACAGACGAAGAGACAAGTAAAAATGACGGAGTAAGCGGAGACACGAAGTTAATAGAGGAGTCTTCGAGTGAGTTGAGATCCATCGGATCGTCAGAACCTTCGCAGAATGAAGGCAGCGCCAGAGCTAACGGAGCTCTCGAATTGCAAAACGTCAAAGCGACGACTGACACCGAGAATTTTTTACAGCAAGAAAAGAAATTTTGTCAGCTCGACTCCTATTTCCCTATATTGAGCGACATTAGATTCACAGGTCCTGCGTCCGAAATAATGAGCACGTCCTTCACGCAAGACTCGCCCACCGAGCCCACCTCCCCCGAGTGCGAGGAGGACAACAAACCTGACGCGGCCGCCGACATCGTGAAAGAGTGGGACAGCGATACTGAATCAGAAACGAGTAACTCGTCCAGCGGAGAATTCATTTGGAAGCAACGAGACAACGCGCCATCTGGTGGAGCGGAGAGTGCAGAGCACGGGTCGGAGGGCGGAGCGGGGTCCGAAGAGTCGGGGGGGTCGGGGGACTCGGGGTCTGAGGGGGACGAGGTCGAGTTCGTTCCCTCCTCCTGGGACTGTCGCGCCGCACCGTCTAAGTCCTCGCTGAGGAGCCTGGAACAAGCTCAACCAGACGGCAAGAAGCGCGTGGTGTTCAAGCGGCAGAAGTACCACTGCGTGTACGAGTACCCGCGCGAGGTCGCCGACCTGGACGCGCCAGACTACTCCACATACGCAGAGTGGGACGCTCGCAGCGCGGAGGAGGCGGCGCTGGGCTACGGGCAGCTGTTCGCGCCGAGCCCGCTCGACCTGCACTCCGGACTCTCCTTCGGCGCCGATTACGACGAAGATTTTTTCATTTCGTCGTCGGCGCGACCGTTCGAAAGTCTCGGGATAATGTCGACCACGAGCCAGTTCTTCCCCGGCATGCACGTGAAGGCGTCGCCGCTGCCGGAGCCCTCGCCGCCCGACGAGGCCGAGGAGCCGCCCGACGAGTCCACCGGGCGCACCGCGCTACCGCACACGCGCGCGCCCAGCCTCGACCTCACCACGCCCGACTCCGGCGTCGAGGACGTGACCCCCGGCTCCGCGCCCCCAGACGACGACTTCGACAAGAAGCCCGCCTCGCCCGAGCCCGCCTGGCGCCTCACCGACAGCGAGCCCACCTCCCCCGCCTCGCCGCCGGAGCTGGGCGGCCTGCGGCACACGCGCGACAAGCTCAAGCTGGACCTCCCGCCGAGCCCCCACGCCGCCTCCCCGAGAGGACTCCGAGTGTTCAACTTCGTACTCGACAAGCCGCGCCGCTCGCCCGCCCTTCAACCCACCTTCTCGACTTTCGGGAAATGCACTCTGGAGCCGGAACCGGAACAGAAGCTCATCCTCACGGACGACGTGGAGCAGGAGGAGGTGAAGCAGGAGAGCCCCAAGGCGTCCATAGAGGGTGTCAAGGGCGAGGGCACCGTGCTGGACAGCGGCGACGAGGACTCCGGCATAGAGAGCAGCTCGAAGGCGACGCTTGAGAGACAGAACAAAACTCCGAATGTTTCATAA
Protein
MQNIANNNAAAYIVSENEERNRISRESVVEFEPLPTELRVADPLERCADWFSGEDFPRNQLQYLREIGRGWFGRVVEGEVDDAGPTKAVAVKILNPNANLEDKARFLDEAKLYRDSRHDTILGYVARCLQEDPWIVIFELCSTDLHQYLTVNRPKMAILNESGVPLRLMCDVTSGLSYLNSRGHLYGNLWSGNVLVRGEADNARAVLGRYTNAESPYEHDAPETRRHPPLYTASSEVWFLGNLIWEVCAWGATPVALPPPLPDLPCPYRNHLYQVMQLCWNTNPDARPTSAQVHGLIDHLYTSHTETTELSQDGSFGTSDFEERWQRLKPNTIPKIDEHVAIVHAPSTSVASHFTGSDRELDDAHTAHDTLSIDMDTAVSRSSSIMSDKDPLSVQIKSESLTNLHGSLEDVRNIYLTHNEMAALECHQGNMQLDEGREKENDKSDSSVDPWVKDIMAGSQDDVSYFKDVSDVIKNLDNMLNSEKTSSSESSHQASPSRDNLSLDCKKEYPVQSSLVKSPGINNFQNILDAGFDTNQDETEDEDVDRDTIGTLSHSFERHSDTISQQTLENLTPETPIKDLVGTGISGLNVPLDLDEVAHDEVDVRNVLPNDKVANSDSEIPKLKELCASSISSVSENIQHVRSEDCQFKCDSNVNKEIDVKEGTKSLDDNLLSSEEAGEFIEEKNDIILDSVDKNVLPNLHTNNKHELICENSGLEREDSKNESSSSYNKQNVEFSDLIENVIDNLVESHVVKSDPNKIDIVNNVVKFNDLEEIKLCESSLEPQSEGENVCNKTSDTIHFTVDSESVKKEFNALDTHEDTETSNISFLKFGEKPISTEDLPKIKMNLPKIKVNKIKCIENNIEEVPIDLNNIEQFPTSETSSQVILLLESNKQNHEKSTDTSNEQIHIVEDINNDGNVHSEEIYSKTLQNNVQATLDFIEAESIKEIDLKSSERGTAKETCSTNESGLNDLEITQSSPTATNDRVQNIENDYEMNNKTETKDLTLENTLNYLDAERTQEHKISSENTIYSFEKIDLENVEVTKLPMDIENSCDSNVCIEGVPKEIDHATALYSTVLSPEQTPSTVQNNVNIESDKASTFSENPIIHSDIKSEIFNNSQSSFLPPEEVQNSDKIFKCELDGNTTKNDTIDTSRSDYVIYDLKEQSNDSTVYLDLVENSGELKQTTKLNKDVGTMPLCLDSSGLQDISLLKNESTVYLDLPTVKVAKEIDNFLHMERLNAESCFKTGLVSSTPLGSDNSVDFADNTNNKDEEIKNILSETKVPDYGPGVTLTKLEQTFVPESLSPFESPTKSHPTDTFDENSSVVLGPFENCSLEIYKGIKSELVDLPKEELLAFSSNFSEMNLETPSPLRDVNFLNEVPDICQDEFYDITSSESKSKVEPDVNENEPKISISDPQTETNTEDSGHSVTEKHVSPSTPPNSPGVFLASTSHHKYLVNIDLDVPKEVPQSTEQVDAVQNEIDLNQIELQITSKLAMAENENNMNIEYSGPLTVEGLEDDVLEESILAGNGGSVEDLREDLTLDEECVKALRNELELKLPLAQVAAIEPQCEAERGEWTAQLPAPPELVLSYPGALSPIAEETGQQLCAYENDANWNASLLTESSESYPEPCNNWTEQSTQPPSPAPSPAPSPVPSPATYSLHTHNHTYTLHKDAPTAEVTMSADSLNASPCKGTKPDVHSPVDDRTYTKNDEKESSCERISQVSPFLVSPTTDTSDNLDNPTGVSTLSKTTLPTDAKLSKQPSECLSKATSIDSWCSNDTLYNVEENFDDLAMDPEPTKGDGNSESTDTLTHDEDDRELSHCSTYIIHDSKSEACETFSPDSIAAYDQYTYTKVRSAATAASSSQLNDSTKNSPTKDLAYGTLMSGMPSYSNCTTEVASMDDPWKFQQPELVRRSPLGEDPDLTPPKLSEDKEIENTSPRIFSEPCIKKMESVEISCLEDNFSESKNKSSSPENEALLIDIGDSPNVNYRNNMAPSITSTPLTEIVGDEDDVQAIPMTFPDDKTVNSEYVMSVPTFQNFQQSAEIRPQDLSSNTDRGTQDTEILLEGDSKTLSRYSNRDSLVVSERTPTYSDFENSATTKPQEVNSRDKSSQSMESGVSSEEFRQFENSVKHRPQDLSSLIDASSLFLRSERLLASELVVAPHSPQPTDEPTAPTTPTTPTTGPLKLTNLTESHILVDVREPTSTYLINFDLEDETEQPHSIIVTEAPLDLFKENSNVTFDSHTEKLIDLNHTYDSHTNRPELRNSIEEAHSESNGDSQPEGPHSIIDYETMQKGSPSQIETSDAISNIKSTPNGSISVDGVNGKNENYATVHFLNETFEELIESNVDDNDRDARTDEETSKNDGVSGDTKLIEESSSELRSIGSSEPSQNEGSARANGALELQNVKATTDTENFLQQEKKFCQLDSYFPILSDIRFTGPASEIMSTSFTQDSPTEPTSPECEEDNKPDAAADIVKEWDSDTESETSNSSSGEFIWKQRDNAPSGGAESAEHGSEGGAGSEESGGSGDSGSEGDEVEFVPSSWDCRAAPSKSSLRSLEQAQPDGKKRVVFKRQKYHCVYEYPREVADLDAPDYSTYAEWDARSAEEAALGYGQLFAPSPLDLHSGLSFGADYDEDFFISSSARPFESLGIMSTTSQFFPGMHVKASPLPEPSPPDEAEEPPDESTGRTALPHTRAPSLDLTTPDSGVEDVTPGSAPPDDDFDKKPASPEPAWRLTDSEPTSPASPPELGGLRHTRDKLKLDLPPSPHAASPRGLRVFNFVLDKPRRSPALQPTFSTFGKCTLEPEPEQKLILTDDVEQEEVKQESPKASIEGVKGEGTVLDSGDEDSGIESSSKATLERQNKTPNVS

Summary

Uniprot
Pfam
PF07714   Pkinase_Tyr
Interpro
IPR017441   Protein_kinase_ATP_BS        + More
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR011009   Kinase-like_dom_sf       
SUPFAM
SSF56112   SSF56112       
ProteinModelPortal
PDB
4XCU     E-value=3.44558e-20,     Score=250

Ontologies

Topology

Length:
2864
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0419
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00194
outside
1  -  2864
 
 

Population Genetic Test Statistics

Pi
232.487621
Theta
193.916475
Tajima's D
0.044992
CLR
0.870423
CSRT
0.381180940952952
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号