Gene

KWMTBOMO10124  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA005650

Annotation

poly(A)-specific_ribonuclease_[Bombyx_mori]

Location

Bomo_Chr17(-):2776607-2783449      View in EpiBrowser

Full name

Poly(A)-specific ribonuclease PARN      

Alternative Name

Deadenylating nuclease
Deadenylation nuclease
Polyadenylate-specific ribonuclease
parn-A

Location in the cell

Nuclear   Reliability : 2.042

CDS

ATGGAAGTAATACGAAAAAATTTCAAAGAGGCATTGCCTCTTGCAGCAGCTTCTGTTAAGAAAGCGGACTTTCTAGTGATAGATACTGAGTTCACTGGCATTATAAACGGCCGGGATGTTTCGATGTTTGACACACCAGAGGAGTATTACAAATGCACTCAGAAAGGTTCTTCGGAATTTCTACTAATACAGTTTGGCCTGTGTGCTTTTCACTGGAATCATAAGGAGAAGCATTACATGAACGACGCATATAATTTTTACCTGTTTCCTCGTGGCAGCCCCGGCCCAGACAGAATGTTCATGTGTCAGAGTTCCAGCTTAGATTTCTTAGCTTCGCAGGGTTTTGATTTCAATAAATTAATAAAAGATGGAATCTCCTACATGACAGTACCTATAGAGTGCAAGCTAAGAGAAAACCTAACAGAGAGACAAAAGACATATTCAAAAGGAAAAGATTCCATTAAGGTACCAGATGAACATAAGGTGTATGTTGAAGACATTTGTAACCAAGTACACCAGTTTTTAGAAGAAGGACAGTTAGACGAAATGGAAATTGACAAGTGTAATTCATTTGTTAGATTATTACTGTTTCAAGAGTTGAGAGCTCGTTTTAAAGACAAAATCTTGGTCGAAACTAAGATTCTAGAAAATAAAAACAGATTATTAAATGTAAAAAGAGTCAAGTCACAGGATGATCTCAAGAACCATGATGCTCTAAAGAAGGAACGAGAGTGGGAAGATTTTGAAGATGCTGTCGGCTTCTCAAAAGTAGCTAGGATGATAAGCGAGTCTGAGAAACTGGTGGTCGGACACAACATGTTACTGGACGTAATGCACACATTGAATCATTTCTTCCAGCCTTTACCTGCAGAATACACCCAGTTCAAAGAGTTTACACACTGCATGTTCCCACATATCTTAGACACAAAATACATGTCAAGTTTGCCTCCATTTAAAGATAAGGTGAATTCAAGCATTCTGAAACATTTGTTGGCAACACTGTCAGCTGCGCCATTTTCTCTGCCTAAAGTTGTGTCCGATGAAGGTCGAGGTTACAGTCAACTCCACGAGAAGCACCACGAAGCCGGCTACGACGCCTACGTCACGGGGCTCTGCTTCCTGGCCATGCACTCGCACCTCGCCAACATGAGGGGCGACGACACCACAAGGTTCCTGTCCATCACGTCGCCGCTCATCAAGCCCTTCCTGAACAAGGTGTTCCTGTCCAGGACGGCTCATCAGGACTCGCCGTTCATAAACCTGGCGGGACCGGAACCACTGCCTCCCAGAGACCACGTGTTTCATTTGGCGTTTCCCAGAGAGTGGCAAAGGAATGAAATCACGCAACTATTTAGTCCGTTTGGTCCAATAACAGTACAATTCATCGATGATACGTCAGCGTTCGTGGCGTTAGCGCGACGTGAACAGGCGACGTCTGTTAGCAAAGCACTCGCGAAGCATTCCAAGATAACCCTCACATCGTATTACAAGTATAAGAAGATTAATGATACGCCCAGCAGTAAGATAACGACGAAAACGGCGGAGGCTGCGAACAACGACTGCAAGAAAACGTATGCAATACTCATTATATCATTAGTGGTAATTTTAATTGCATTCTTCCTGCGTGGCTTCAATAAGCTATACTGA

Protein

MEVIRKNFKEALPLAAASVKKADFLVIDTEFTGIINGRDVSMFDTPEEYYKCTQKGSSEFLLIQFGLCAFHWNHKEKHYMNDAYNFYLFPRGSPGPDRMFMCQSSSLDFLASQGFDFNKLIKDGISYMTVPIECKLRENLTERQKTYSKGKDSIKVPDEHKVYVEDICNQVHQFLEEGQLDEMEIDKCNSFVRLLLFQELRARFKDKILVETKILENKNRLLNVKRVKSQDDLKNHDALKKEREWEDFEDAVGFSKVARMISESEKLVVGHNMLLDVMHTLNHFFQPLPAEYTQFKEFTHCMFPHILDTKYMSSLPPFKDKVNSSILKHLLATLSAAPFSLPKVVSDEGRGYSQLHEKHHEAGYDAYVTGLCFLAMHSHLANMRGDDTTRFLSITSPLIKPFLNKVFLSRTAHQDSPFINLAGPEPLPPRDHVFHLAFPREWQRNEITQLFSPFGPITVQFIDDTSAFVALARREQATSVSKALAKHSKITLTSYYKYKKINDTPSSKITTKTAEAANNDCKKTYAILIISLVVILIAFFLRGFNKLY

Description

3'-exoribonuclease that has a preference for poly(A) tails of mRNAs, thereby efficiently degrading poly(A) tails. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. Required during meiotic maturation to silence certain maternal mRNAs translationally. Does not require an adenosine residue at the 3' end, however, the addition of 25 non-adenylate residues at the 3' terminus, or a 3' terminal phosphate is inhibitory. Involved in dormant mRNAs regulation during oocyte maturation by counteracting polyadenylation mediated by papd4/gld2nt in immature eggs. During maturation it is excluded from the ribonucleoprotein complex, allowing poly(A) elongation by papd4/gld2nt and activation of mRNAs.
3'-exoribonuclease that has a preference for poly(A) tails of mRNAs, thereby efficiently degrading poly(A) tails. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs and is also used to silence certain maternal mRNAs translationally during oocyte maturation and early embryonic development. Involved in nonsense-mediated mRNA decay, a critical process of selective degradation of mRNAs that contain premature stop codons. Also involved in degradation of inherently unstable mRNAs that contain AU-rich elements (AREs) in their 3'-UTR, possibly via its interaction with KHSRP. Probably mediates the removal of poly(A) tails of AREs mRNAs, which constitutes the first step of destabilization (By similarity). Interacts with both the 3'-end poly(A) tail and the 5'-end cap structure during degradation, the interaction with the cap structure being required for an efficient degradation of poly(A) tails (By similarity) (PubMed:10698948, PubMed:9736620). Also able to recognize poly(A) tails of microRNAs such as MIR21 and H/ACA box snoRNAs (small nucleolar RNAs) leading to microRNAs degradation or snoRNA increased stability (By similarity).
3'-exoribonuclease that has a preference for poly(A) tails of mRNAs, thereby efficiently degrading poly(A) tails. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs and is also used to silence certain maternal mRNAs translationally during oocyte maturation and early embryonic development. Interacts with both the 3'-end poly(A) tail and the 5'-end cap structure during degradation, the interaction with the cap structure being required for an efficient degradation of poly(A) tails. Involved in nonsense-mediated mRNA decay, a critical process of selective degradation of mRNAs that contain premature stop codons. Also involved in degradation of inherently unstable mRNAs that contain AU-rich elements (AREs) in their 3'-UTR, possibly via its interaction with KHSRP. Probably mediates the removal of poly(A) tails of AREs mRNAs, which constitutes the first step of destabilization (PubMed:10882133, PubMed:11359775, PubMed:12748283, PubMed:15175153, PubMed:9736620). Also able to recognize and trim poly(A) tails of microRNAs such as MIR21 and H/ACA box snoRNAs (small nucleolar RNAs) leading to microRNAs degradation or snoRNA increased stability (PubMed:25049417, PubMed:22442037).
3'-exoribonuclease that has a preference for poly(A) tails of mRNAs, thereby efficiently degrading poly(A) tails. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs and is also used to silence certain maternal mRNAs translationally during oocyte maturation and early embryonic development. Interacts with both the 3'-end poly(A) tail and the 5'-end cap structure during degradation, the interaction with the cap structure being required for an efficient degradation of poly(A) tails. Involved in nonsense-mediated mRNA decay, a critical process of selective degradation of mRNAs that contain premature stop codons. Also involved in degradation of inherently unstable mRNAs that contain AU-rich elements (AREs) in their 3'-UTR, possibly via its interaction with KHSRP. Probably mediates the removal of poly(A) tails of AREs mRNAs, which constitutes the first step of destabilization (By similarity). Also able to recognize poly(A) tails of microRNAs such as MIR21 and H/ACA box snoRNAs (small nucleolar RNAs) leading to microRNAs degradation or snoRNA increased stability (By similarity).

Catalytic Activity

Exonucleolytic cleavage of poly(A) to 5'-AMP.

Cofactor

a divalent metal cation
Mg(2+)

Subunit

Component of a complex at least composed of cpeb1, cpsf1, papd4/gld2, pabpc1/ePAB, parn and sympk.
Homodimer. Found in a mRNA decay complex with RENT1, RENT2 and RENT3B. Interacts with KHSRP. Interacts with CELF1/CUGBP1. Interacts with ZC3HAV1 in an RNA-independent manner. Interacts with DHX36.
Homodimer (PubMed:10801819, PubMed:16281054). Found in a mRNA decay complex with RENT1, RENT2 and RENT3B (PubMed:14527413). Interacts with KHSRP (PubMed:15175153). Interacts with CELF1/CUGBP1 (PubMed:16601207). Interacts with ZC3HAV1 in an RNA-independent manner (PubMed:21876179). Interacts with DHX36 (PubMed:14731398).

Similarity

Belongs to the CAF1 family.

Keywords

Cytoplasm   Direct protein sequencing   Exonuclease   Hydrolase   Meiosis   Metal-binding   Nuclease   Nucleus   RNA-binding   Acetylation   Complete proteome   Magnesium   Nonsense-mediated mRNA decay   Phosphoprotein   Reference proteome   3D-structure   Alternative splicing   Disease mutation   Dyskeratosis congenita  

Feature

chain  Poly(A)-specific ribonuclease PARN
splice variant  In isoform 2.
sequence variant  In DKCB6; dbSNP:rs786200999.

Uniprot

H9J808   B9X256   A0A2A4JHI6   A0A3S2NI25   A0A173FD15   D0AB72   + More
A0A212FKP2   L7X1H3   A0A2H1VJ40   A0A194QAQ6   A0A1E1W4W7   A0A2J7QAK1   A0A067R0F3   A0A1S3JBU0   T1JBS2   A0A1S3K3F2   A0A2P8YJZ6   E9IBK7   A0A087ZTK8   A0A1Y1LHM7   A0A026WYM1   A0A226MLI7   A0A3L8D835   A0A2A3E552   B5DFR2   A0A0M9A5A4   Q07G83   D6WYW0   F6UAK5   A0A1L8EQ87   A0A1L8EXJ1   Q90ZA1   K7IX58   A0A2P4TFY5   E2AZW9   A0A232F832   W5PCG5   A0A2U9BNZ1   A0A3B4ZT46   U3D8R3   F1NEI8   E2C8P3   A0A093G7B5   G3TEC9   P69341   A0A2J8R143   A0A0D9R712   A0A2K6EAH7   S4RGQ4   A0A2Y9DES8   A0A2J8JL49   I3IUA4   A0A099Z7R2   H9FV31   W5U5L5   G3RWB8   A0A2Y9QXV2   O95453   G1LXQ5   A0A2R9APG9   K7BWE4   A0A250Y414   Q5RC51   A0A0S3NU58   A0A3B4UNQ9   W5LXH8   G1RH04   F6Q3J7   I3M9X4   A0A384CJZ2   A0A3Q7XN02   A0A2K5E2Q6   A0A3Q2LEK8   A0A2K5RAN0   I3IUA3   A0A337S613   A0A2T7PXW8   W5LXE4   F6XLZ1   H3CS48   A0A0L7R0U2   A0A2U4ATD1   A0A287AI76   M3YSP4   A0A1S3WJL1   K7G9L5   A0A1S3ES48   G3Q7C0   A0A341BBS8   A0A2Y9LRG7   A0A2Y9KH53   F6XU41   A0A341BF47   A0A3Q0D5Z0   A0A3Q3LTX5   A0A340Y131   A0A3P9C7U1   A0A3Q3A9J3  

EC Number

3.1.13.4

Pubmed

19121390    27251284    22118469    23674305    26354079    24845553    + More
29403074    21282665    28004739    24508170    30249741    18362917    19820115    20431018    27762356    11424938    9736620    12573214    17052452    20075255    20798317    28648823    20809919    25243066    15592404    9099687    10698948    25186727    17431167    25319552    23127152    22398555    14702039    15616553    15489334    10640832    10801819    10882133    11359775    11742007    12429849    14527413    12748283    14731398    15175153    15358788    16964243    16601207    18669648    19413330    19690332    19608861    20932473    20068231    21269460    21876179    21406692    22442037    23186163    24275569    25049417    25893599    25848748    16281054    20010809    22722832    16136131    28087693    26514418    19892987    24813606    17975172    15496914    17381049    16341006    28071753   

EMBL

BABH01020223    AB485782    BAH23570.1    NWSH01001365    PCG71535.1    RSAL01000090    + More
RVE48111.1    KT182637    ANG83463.1    FP102339    CBH09267.1    AGBW02008005    OWR54317.1    KC469893    AGC92706.2    ODYU01002851    SOQ40847.1    KQ459232    KPJ02618.1    GDQN01009050    JAT82004.1    NEVH01016330    PNF25589.1    KK852804    KDR16211.1    JH432018    PYGN01000541    PSN44566.1    GL762111    EFZ22121.1    GEZM01055097    JAV73149.1    KK107078    EZA60239.1    MCFN01000669    OXB56142.1    QOIP01000011    RLU16444.1    KZ288368    PBC26818.1    BC169159    AAI69159.1    KQ435732    KOX77527.1    CR760641    CAL49352.1    KQ971363    EFA07855.1    AAMC01046567    AAMC01046568    AAMC01046569    AAMC01046570    AAMC01046571    AAMC01046572    AAMC01046573    CM004483    OCT61470.1    CM004482    OCT64052.1    AF309688    BC068919    BC073682    AAZX01000623    PPHD01000639    POI35266.1    GL444280    EFN61018.1    NNAY01000683    OXU26994.1    AMGL01068514    AMGL01068515    AMGL01068516    AMGL01068517    AMGL01068518    AMGL01068519    CP026250    AWP05326.1    GAMT01002170    GAMS01007066    GAMR01005114    GAMQ01002084    GAMP01008800    JAB09691.1    JAB16070.1    JAB28818.1    JAB39767.1    JAB43955.1    AADN05000376    GL453666    EFN75773.1    KL215669    KFV66105.1    BC150015    NDHI03003836    PNJ02239.1    AQIB01118291    AQIB01118292    AQIB01118293    AQIB01118294    AQIB01118295    AQIB01118296    AQIB01118297    AQIB01118298    AQIB01118299    NBAG03000447    PNI23493.1    AERX01047414    KL889709    KGL77093.1    JSUE03025737    JSUE03025738    JSUE03025739    JSUE03025740    JU334737    JU472194    JV045146    AFE78490.1    AFH28998.1    AFI35217.1    JT405467    AHH37193.1    CABD030099076    CABD030099077    CABD030099078    CABD030099079    CABD030099080    CABD030099081    CABD030099082    CABD030099083    CABD030099084    CABD030099085    AJ005698    AK293189    AK299653    AK301648    AK315020    AC009167    AC092291    KF456163    CH471112    BC050029    ACTA01011153    ACTA01019153    ACTA01027153    ACTA01035153    ACTA01043152    AJFE02117450    AJFE02117451    AJFE02117452    AJFE02117453    AJFE02117454    AJFE02117455    AJFE02117456    AJFE02117457    AJFE02117458    AJFE02117459    AACZ04058832    AC192135    GABC01005196    GABF01005845    GABD01010747    GABE01002844    GABE01002843    JAA06142.1    JAA16300.1    JAA22353.1    JAA41895.1    GFFV01001666    JAV38279.1    CR858430    AB984736    LC192268    BAT46600.1    BBG62308.1    AHAT01032371    ADFV01049477    ADFV01049478    ADFV01049479    ADFV01049480    ADFV01049481    ADFV01049482    ADFV01049483    ADFV01049484    ADFV01049485    ADFV01049486    AGTP01030790    AGTP01030791    AGTP01030792    AGTP01030793    AGTP01030794    AANG04001668    PZQS01000001    PVD38240.1    KQ414669    KOC64462.1    AEMK02000018    AEYP01027405    AEYP01027406    AEYP01027407    AEYP01027408    AEYP01027409    AEYP01027410    AEYP01027411    AEYP01027412    AEYP01027413    AEYP01027414    AGCU01158713    AGCU01158714    AGCU01158715    AGCU01158716    AGCU01158717    AGCU01158718    AGCU01158719    AGCU01158720    AGCU01158721    AGCU01158722    AAEX03004504    AAEX03004505   

Proteomes

UP000005204    UP000218220    UP000283053    UP000007151    UP000053268    UP000235965    + More
UP000027135    UP000085678    UP000245037    UP000005203    UP000053097    UP000198323    UP000279307    UP000242457    UP000053105    UP000007266    UP000008143    UP000186698    UP000002358    UP000000311    UP000215335    UP000002356    UP000246464    UP000261400    UP000008225    UP000000539    UP000008237    UP000053875    UP000007646    UP000009136    UP000029965    UP000233120    UP000245300    UP000248480    UP000005207    UP000053641    UP000006718    UP000001519    UP000005640    UP000008912    UP000240080    UP000002277    UP000001595    UP000261420    UP000018468    UP000001073    UP000002281    UP000005215    UP000261680    UP000291021    UP000286642    UP000233020    UP000233040    UP000011712    UP000245119    UP000007303    UP000053825    UP000245320    UP000008227    UP000000715    UP000079721    UP000007267    UP000081671    UP000007635    UP000252040    UP000248483    UP000248482    UP000002254    UP000189706    UP000261660    UP000265300    UP000265160    UP000264800   

PRIDE

H9J808    B9X256    P69341    O95453    Q5RC51   

Pfam

PF04857   CAF1        + More
PF08675   RNA_bind
PF01424   R3H

Interpro

IPR012337   RNaseH-like_sf        + More
IPR006941   RNase_CAF1       
IPR035979   RBD_domain_sf       
IPR036867   R3H_dom_sf       
IPR036397   RNaseH_sf       
IPR012677   Nucleotide-bd_a/b_plait_sf       
IPR014789   PolyA-riboNase_RNA_binding       
IPR034042   PARN_R3H       
IPR001374   R3H_dom       

SUPFAM

SSF53098   SSF53098        + More
SSF82708   SSF82708       
SSF54928   SSF54928       

Gene 3D

3.30.1370.50     3.30.420.10     3.30.70.330    

CDD

cd02637  R3H_PARN

ProteinModelPortal

H9J808   B9X256   A0A2A4JHI6   A0A3S2NI25   A0A173FD15   D0AB72   + More
A0A212FKP2   L7X1H3   A0A2H1VJ40   A0A194QAQ6   A0A1E1W4W7   A0A2J7QAK1   A0A067R0F3   A0A1S3JBU0   T1JBS2   A0A1S3K3F2   A0A2P8YJZ6   E9IBK7   A0A087ZTK8   A0A1Y1LHM7   A0A026WYM1   A0A226MLI7   A0A3L8D835   A0A2A3E552   B5DFR2   A0A0M9A5A4   Q07G83   D6WYW0   F6UAK5   A0A1L8EQ87   A0A1L8EXJ1   Q90ZA1   K7IX58   A0A2P4TFY5   E2AZW9   A0A232F832   W5PCG5   A0A2U9BNZ1   A0A3B4ZT46   U3D8R3   F1NEI8   E2C8P3   A0A093G7B5   G3TEC9   P69341   A0A2J8R143   A0A0D9R712   A0A2K6EAH7   S4RGQ4   A0A2Y9DES8   A0A2J8JL49   I3IUA4   A0A099Z7R2   H9FV31   W5U5L5   G3RWB8   A0A2Y9QXV2   O95453   G1LXQ5   A0A2R9APG9   K7BWE4   A0A250Y414   Q5RC51   A0A0S3NU58   A0A3B4UNQ9   W5LXH8   G1RH04   F6Q3J7   I3M9X4   A0A384CJZ2   A0A3Q7XN02   A0A2K5E2Q6   A0A3Q2LEK8   A0A2K5RAN0   I3IUA3   A0A337S613   A0A2T7PXW8   W5LXE4   F6XLZ1   H3CS48   A0A0L7R0U2   A0A2U4ATD1   A0A287AI76   M3YSP4   A0A1S3WJL1   K7G9L5   A0A1S3ES48   G3Q7C0   A0A341BBS8   A0A2Y9LRG7   A0A2Y9KH53   F6XU41   A0A341BF47   A0A3Q0D5Z0   A0A3Q3LTX5   A0A340Y131   A0A3P9C7U1   A0A3Q3A9J3  

PDB

3D45     E-value=1.11953e-109,     Score=1015

KEGG

100301509    K01148 poly(A)-specific ribonuclease [EC:3.1.13.4] | (RefSeq) Parn; poly(A)-specific ribonuclease

PATHWAY

03018    RNA degradation - Bombyx mori (domestic silkworm)

GO

GO:0003723   GO:0004535   GO:0006402   GO:0046872   GO:0005634   GO:0005737   GO:0016021   GO:0003676   GO:0000175   GO:0000289   GO:0043169   GO:0051321   GO:0019901   GO:0032212   GO:0051973   GO:0005730   GO:0010587   GO:0071051   GO:0110008   GO:0000495   GO:0090669   GO:1904872   GO:0000184   GO:0005829   GO:0070034   GO:0007292   GO:0043488   GO:0003730   GO:0004518   GO:0009451   GO:0090503   GO:0000166   GO:0003824  

Subcellular location

Cytoplasm  
Nucleus  
Nucleolus   Some nuclear fraction is nucleolar.   With evidence from 1 publications.

Length:

548

Number of predicted TMHs:

1

Exp number of AAs in TMHs:

20.71512

Exp number, first 60 AAs:

0.005

Total prob of N-in:

0.13041

outside

1  -  524

TMhelix

525  -  544

inside

545  -  548

 

 

Pi

225.321666

Theta

172.86612

Tajima's D

0.955761

CLR

0.149072

CSRT

0.648267586620669

Interpretation

Uncertain