SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10120
Pre Gene Modal
BGIBMGA003203
Annotation
blastopia_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.514
 

Sequence

CDS
ATGGCAAGACGACGATCAAAAAGCCAGTCCTTCGATGACGACGACAGTATTTTCGATCGACCAACGCGTGGTGGAATGTTTCACTTAACGGAGAATATCATCAGGAAGTTTGACGGCAAAGACAAAACTTATGCTGTAACAAAGTGGATACAAGATATAGAGGAAAATGGTGACATATTCGAGTGGACACCAAAGCAACGGTTATTAGTGGCTCGACGGTCATTAACCGGCACGGCAGCTTTGTGGTTAAATTCTGAAAAAACGTTTCCATGCTGGGATACTTTAAAGATAGCCATCAGTAAGGAGTTCCCTGACACCATAGACGCCAAGACTATTCACGAAATGATGAGTGCTAAAAAGAAAAAGTCAAATGAATCATGCATTGACTACATGTTTGCCATGAAAGAGCTTGGACGCCGAGGCAAAATGGCGGACTACGTGGCTATAAAATATGTTGTAGATGGCATACAAGATCAAGAAATAAATAAAATAATGCTATATGGAGTCACAACGTACGCTGAATTAAAGGAGAAATTAAAAATATACGAGATTTTGAAAGAAAAAATGAAGAAAGAACCTATTCACGGAAAAGAGCAGAAAATTACTAATACAAGAGAATGGTCATCAAAAGTTCGATGTTATAGCTGTGGAGAAAAGAGTCATAAAAGTGAAGATTGCCCGAAAAAGATGCAAGGAAAAAAGTGTTTCAACTGCAACGTGTTCGGCCATATTTCTTCACAATGTCCGGCAAAGGCGGAAGCGTCATCGGCTACGGCTAGCAGCGCGAGAACAGAGCAGCAACCGAAACGCACGTATATCGCTACGACGCAGGAGGGCGCGAACACAATTTTCGAAAATCAATCTAACGAAGTTCACAACGCTATGAATGCTGTGATTGGCTCTGCGAACAGTACGGTGCGCGACAAATGTCATAACAGTGAGGTTGACATTTTAAAAGTAAATAAAGAATGTAAAGTGTTGAAAAAAACTTTGAAATTAGTAAAATTGTGTAATAATAACGAAATTCATGCATTAATTGATACTGGTAGTGAAGTTAATTTAGTAACCATGGACTATTATGAGCAAATAGGCTCTCCGACGTGTTTTAAAAATGTAAACACAGTTCTTACCGGTTTAGGCTCATCAAAGGTAATATCAACTGAACAATTTAAAACAAACATTGAAATCGACGGCTACACGTATCGTGATATAATATTTTATGTGATTCCTAGAGACAGTATACCTATTAAAGTGATATTGGGACATGAATTTTTAAGAAATGTTATTACAGTTATGAAAGATGGTTTGGTATGGATGAAACCAAATGATTGGTTGTTTAAGGTAAATTGTTTTCCATGTTCTATTGACATTGTAGGTCATGTTATGAATGAAAATGTGAGGAATGAAGTGACTAGGTTAGTAGATGAATATCGGCCATGTCAAACTAAAGAGGCTCCCATTGAGTTGAAAATCACACTTAAAGACGACATCCCAGTGGCTCAACGACCACGACGCATCTCACCAAAAGAACAGGATGAGGTAGATAAACAGGTTAAGGAGTGGCTGGAACAAGGAGTTATTCGGGTAAGCTTTTCTGAATATACTAGCCCAATTGTTCTTGTCAGAAAGGATAAGCAGTTTGAATTTAACAATGAACATAGATTAGTTTTCAATATGCTTAAGGAAAAGTTGACCAGTAATCCTGTATTGAAAATTTATGAACCAAAAGCAGAAACAGAACTTCATACAGATGCCTCAAGTATAGCATATGCGGCTATATTATTACAGAAAGATGACAACAGTGAACTACATCCAGTACATTATATGAGCAAGCGAACAACTGACGCTGAGAGTAAATATACAAGTTATGAGCTAGAAGCTTTGGCTATAATAGAAGGTATAAAGAAGTTTAGACATTATTTATACGGAAAGCATTTTAAGATAGTTACAGACTGCAAAGCTTTTCAAATGACACTGAATAAAAAAGATCTAGCAATGAGTACGAGAGTGGCACGATGGATATTGTTCTTACAAGATTATGATTTCACTATTGAACATCGTGAAGGTTCGAAGATGAAACACACAGATGCTCTAAGCCGAAACCCATATGTAGCTCTTATATTTTCAGACCTACATAGTGATTTAAGACGTGCGCAAGAGAGTGACAACGGATTAAATGCAATTATAAATATTCTGAGAGATGGTAAACTATATAATGACTTTTATTTGCAAGGATTACTCTGCAAGGGACCACAACATTGTTTGGTTGTACCACAGAAGATGGAAATTGAAATTATTAAGAGGGCGCATGATAATGGTCATTTTTCAAAGAAGAAAACATTGGAATTGATTAATAAGGATTATTACATACCAAAATTAGAGAAAAAGATTGAGGATTATATTGCTACATGCATACCTTGTCTGTTAGCATCCCGTAAAGAAGGTAAACGAGAAGGATTTTTGAATCCCATAGAAAAGGGTGACACACCATTACATACACTTCACCTGGACCACATTGGACCACTTACGGAGACACGTAAGCAATATAATTACATATTGACTATTGTTGACGCATTCACCAAGTTTGTATGGTTGTTCCCTACAAAGAGTACATCTACCCAAGAAGTGTTAAATAAGCTGGAAATACATCAACAAGTATTTGGTAATCCTATAAGAATTATTTCAGATAGAGGGACTGCATTTACGAGTAACGATTTTGCACAGTACTGTAAAGAGGAAGAAATAGAGCATGTAAAAATAACAACAGGGGTTCCCAGAGGAAACGGTCAGGTTGAAAGGGTTCATAGAACAATAATTTCAGTACTGACAAAACTTTCAGTTGAGAAACCTACATTGTGGTATAAGTTGGTAAGCAGAGTTCAAAGAGCACTCAACAGTACTTACCACAGGAGTATAAATAGTACCCCATTTCAATTACTCTTTGGAATAAAAATGAAGAGGAAAGAAGATATTCAATTACTGGACCTTTTGATGGAAGAAGAAAGACACAATTTCATTGACAGTAGAGAAGAACTTAGGAAGGAAGCGAAGAAACAAATATTTAAAGTACAAGAAGAAAATAGAAGAAATTACAACAAGAAAATGAAAGAATGTACTATATACAAGGAAGGCGACTTAGTAGCTGTGAAAAGGACTCAGTTTGGTACAGGAATGAAACTGAAACCAAAGTTTTTGGGACCATATCGAATAGTAAAGGTCAAAAGAAAGAATAGATACAATGTTGAGAAGGCTGACGCACAAGTTGAAGGCCCTAACAAGACTACTACATCTGCTGATTTTATGAAAAAGTGGCCTGATTACTTAAGTGACTGA
Protein
MARRRSKSQSFDDDDSIFDRPTRGGMFHLTENIIRKFDGKDKTYAVTKWIQDIEENGDIFEWTPKQRLLVARRSLTGTAALWLNSEKTFPCWDTLKIAISKEFPDTIDAKTIHEMMSAKKKKSNESCIDYMFAMKELGRRGKMADYVAIKYVVDGIQDQEINKIMLYGVTTYAELKEKLKIYEILKEKMKKEPIHGKEQKITNTREWSSKVRCYSCGEKSHKSEDCPKKMQGKKCFNCNVFGHISSQCPAKAEASSATASSARTEQQPKRTYIATTQEGANTIFENQSNEVHNAMNAVIGSANSTVRDKCHNSEVDILKVNKECKVLKKTLKLVKLCNNNEIHALIDTGSEVNLVTMDYYEQIGSPTCFKNVNTVLTGLGSSKVISTEQFKTNIEIDGYTYRDIIFYVIPRDSIPIKVILGHEFLRNVITVMKDGLVWMKPNDWLFKVNCFPCSIDIVGHVMNENVRNEVTRLVDEYRPCQTKEAPIELKITLKDDIPVAQRPRRISPKEQDEVDKQVKEWLEQGVIRVSFSEYTSPIVLVRKDKQFEFNNEHRLVFNMLKEKLTSNPVLKIYEPKAETELHTDASSIAYAAILLQKDDNSELHPVHYMSKRTTDAESKYTSYELEALAIIEGIKKFRHYLYGKHFKIVTDCKAFQMTLNKKDLAMSTRVARWILFLQDYDFTIEHREGSKMKHTDALSRNPYVALIFSDLHSDLRRAQESDNGLNAIINILRDGKLYNDFYLQGLLCKGPQHCLVVPQKMEIEIIKRAHDNGHFSKKKTLELINKDYYIPKLEKKIEDYIATCIPCLLASRKEGKREGFLNPIEKGDTPLHTLHLDHIGPLTETRKQYNYILTIVDAFTKFVWLFPTKSTSTQEVLNKLEIHQQVFGNPIRIISDRGTAFTSNDFAQYCKEEEIEHVKITTGVPRGNGQVERVHRTIISVLTKLSVEKPTLWYKLVSRVQRALNSTYHRSINSTPFQLLFGIKMKRKEDIQLLDLLMEEERHNFIDSREELRKEAKKQIFKVQEENRRNYNKKMKECTIYKEGDLVAVKRTQFGTGMKLKPKFLGPYRIVKVKRKNRYNVEKADAQVEGPNKTTTSADFMKKWPDYLSD

Summary

Uniprot
ProteinModelPortal
PDB
3S3O     E-value=3.39419e-35,     Score=376

Ontologies

Topology

Length:
1110
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00714999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00024
outside
1  -  1110
 
 

Population Genetic Test Statistics

Pi
164.853264
Theta
144.669854
Tajima's D
0.083604
CLR
208.272525
CSRT
0.389680515974201
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号