SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10107  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA005552
Annotation
PREDICTED:_U3_small_nucleolar_RNA-associated_protein_14_homolog_A_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 4.041
 

Sequence

CDS
ATGGAAGGTATTGATGATATAGAGCACATAGCTTCGGACCATGATCAACTAATTAGTGTGATTTCCAAATTAGATAAAACTCAGCATATAATAGAGCCCACACGCAACGAGCCCACAAACATCAATTCAGAATTTAATTTGATAAAAAAATCGAATAAGTCAATTTTGAAAAATGTTTCTAACATTTTGAGTGATACTGCTTCACATGTAGAGATTACGAAAAAATTGCTGAAAAGCCAGGAAGAGTCCAAGGTCTTAAGTAAACCATTAGAAAAACCACAGGTTGAGCGTATAAAGCGAGCGACAGGATATTTAGAAACAAAAAAGAAAGTTGGTCGGTGGGACCCCATTGTTGCTCGCAGTCGAACAGTGGACCAGGTTTTCTTTCCTTTGAAAAAAGCAGAAAATAGATTGCAGCCAACGCAAGCCTTCATTTCAAAATTAAAAACTAAATCTGAACTAGAACGCGAATTGGAGGCAGTAGATCCACCAGATATTGTTCAGGAAGACGATGAGGAAGAACAGGTGTACCCAATGTCGTATGAAGAAATGGTTGAACACAGGCAACATTTGGCAAAAATACGAGCTCAAGAATCATATAGAGCTGCAAAAGCTAAACGCCAAAGTAAAATCAAGAGCAAGAAATATCATAGAATTTTGAAGAAAGACAGGCTAAAACAACAGTTAAAAGAGTTTGAAGAATTACAAAAAAGTAATCCAGAGGAGGCCTTAAAGAAATTGGAGGCTCTGGAAAAATCTAGAGCATTAGAAAGACATACACTGCGGCATAAGAACACTGGAAAGTGGGCAAAAAATAAAATGATCAGAGCAAAGTATGATAAAGAGGCTCGGCAAGAAATAGCAGAACAGTTAGCAGTTAGTCGAAGTTTGACACAAAAGACACAAGACCCTGATAGTTCAGATGATGATGCAGAAGATAATGTAGTTATTCCTGATATTGCTTTAGCACAAGACCCGATGAATCCTTGGATGTTGAAACAAAACAATAAGTCTAATGTTGATGCAGAATTTGATTTCGGCTACAAAAAATATTTGAAAGGAAAAATGTTTAAACATAAAGAAGACAGTGGTAGTGAAGATGAAGCAGAAAAAAATAATGATACTACAAAAGCATGTTCTGATGCTGGATTAAATACTTTAAAAAATAAAATTGAGAAAATATTTAACAACAAAAATGAAAGTGCACAAATTGATAAAAATATTGAAGAAGACAACAGTACTGAACAAAATCAATCAGATCTGAATCAACCAATTCAGAACAATTCCAATATTACAAAAAACAAGATTGTTGAAACAGAACAAAAACAAAAAGAAAACAAAATGAAGAAAAATAAAGAAACTCTTAACAATAATAAAAAATCCCTTAAAACTAAACTGGTAGCAACATCTTATTGGACTGTTGAACCTGTAGAGAATAAAGATAAAAAGTACACTGAAGGTGTTGGGGGTGCATTTGATAATTTGGAAAGAAACATATCGAAACAAGTTAATATGAAATTAGATATTTTCAGGAGGAAATTAAGAAAGCTTGAACAGCTAACAGCTTCAAAGAGTAAAAAGAAATCCAAAAGAATAGGAAACAGTGAATCATATATACCTGAGAATAATTTGGAGTACTTAAAATTAGCAACTCAAAATAAGAAAGCTATAATTGATGAACAGTTACTAGAAACTACTTCAAAAACTATTCCTACTGAAGAAACAATATCTGATGATATTATGTCGAGGGCTATGCTACATAACAAGATTCCAGCTGAGGAACCTACAAACTCAAACATTGATCCCAGTAAATTTATTGAGGTCAAACCGAAATTCTTAAACTCTGAAATATCTCGACAAGAAACTGAATTAGATGTTTTAGATGATGAACAAGTTGTACCAAAAGTCAATATAGAAGAAGTATTTGAGGAAGATGATGTTGTAGCTAGCTTTAGGCAAGAAAAAGAAGATGAGGCTAATAAAGATAAGCCCGAAGATATTAACTTGACTCTGCCAGGATGGGGAGCGTGGGGAGGAAAAGGAGTGAAAGCACCGAAACGAAAAAGAAATAGATTCATTACTAAATTTGCCCCAAAAACTCCCAGGAGGGATGAGAACAAAGGTGATGTAATCATTAAAGAATACAAGGATCTAAAATTGGATGCACATAAAGTAAAAGAACTCCCATATCCTTTCAACAGTGTTAAAGAATTCGAGGCCTCACTAAGAGCTCCATTAGGCAACACATTTATACCTGAGACTGCACACCGAAAACTTACACGTCCAAATGTTGTCACTATGGCAGGCGCTATTATAGAACCTATGGATGAAGATGAATTGTTACAAAAGAAGAATCGTACCTTTAAATCATCCAACGTGATACAATTCATAAATAAAGATGGTTGA
Protein
MEGIDDIEHIASDHDQLISVISKLDKTQHIIEPTRNEPTNINSEFNLIKKSNKSILKNVSNILSDTASHVEITKKLLKSQEESKVLSKPLEKPQVERIKRATGYLETKKKVGRWDPIVARSRTVDQVFFPLKKAENRLQPTQAFISKLKTKSELERELEAVDPPDIVQEDDEEEQVYPMSYEEMVEHRQHLAKIRAQESYRAAKAKRQSKIKSKKYHRILKKDRLKQQLKEFEELQKSNPEEALKKLEALEKSRALERHTLRHKNTGKWAKNKMIRAKYDKEARQEIAEQLAVSRSLTQKTQDPDSSDDDAEDNVVIPDIALAQDPMNPWMLKQNNKSNVDAEFDFGYKKYLKGKMFKHKEDSGSEDEAEKNNDTTKACSDAGLNTLKNKIEKIFNNKNESAQIDKNIEEDNSTEQNQSDLNQPIQNNSNITKNKIVETEQKQKENKMKKNKETLNNNKKSLKTKLVATSYWTVEPVENKDKKYTEGVGGAFDNLERNISKQVNMKLDIFRRKLRKLEQLTASKSKKKSKRIGNSESYIPENNLEYLKLATQNKKAIIDEQLLETTSKTIPTEETISDDIMSRAMLHNKIPAEEPTNSNIDPSKFIEVKPKFLNSEISRQETELDVLDDEQVVPKVNIEEVFEEDDVVASFRQEKEDEANKDKPEDINLTLPGWGAWGGKGVKAPKRKRNRFITKFAPKTPRRDENKGDVIIKEYKDLKLDAHKVKELPYPFNSVKEFEASLRAPLGNTFIPETAHRKLTRPNVVTMAGAIIEPMDEDELLQKKNRTFKSSNVIQFINKDG

Summary

Interpro
IPR006709   SSU_processome_Utp14       
PDB
5OQL     E-value=1.82093e-08,     Score=144

Ontologies

Topology

Length:
801
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  801
 
 

Population Genetic Test Statistics

Pi
47.208766
Theta
200.983196
Tajima's D
-0.541849
CLR
200.240962
CSRT
0.230838458077096
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号