SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10106
Annotation
AF461149_1_transposase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.903
 

Sequence

CDS
ATGATAAGGTGTACGCACACATTAGTGAAGAAGCGAGCAACCGTATTCCGCGTGTCCATCCGAGGTCATTTTCCATCCTCGCTCATGGTATGGTTGGGAGTTTCTTATTGGGGCTTAACAGAGGTACATTTTTGTGAGAAAGGTGTAAAAACGAATGCAGTTGTGTATCAAAATACAGTCCTGACGCACCTTGTGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGATGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGATGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MIRCTHTLVKKRATVFRVSIRGHFPSSLMVWLGVSYWGLTEVHFCEKGVKTNAVVYQNTVLTHLVEPVSHTMFNNRHWVFQQDSAPAHRAMSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHPNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLMACIQNHGGHFE

Summary

Similarity
Belongs to the TGF-beta family.
EMBL
AF461149    AAN06610.1    AB363028    BAG15927.1    AB363006    AB363010    + More
AB363014    BAG15923.1    BAG15924.1    AB473770    BAH20555.1    AB363018    BAG15926.1    RSAL01000012    RVE53510.1    RSAL01000114    RVE46946.1    RSAL01000174    RVE45058.1    RSAL01000021    RVE52408.1    U47917    AAB47739.1    JF779677    AEO90418.1    RSAL01000063    RVE49524.1    RSAL01000209    RVE44259.1    RSAL01000140    RVE46091.1    RSAL01000470    RVE41612.1    LNIX01000030    OXA41211.1    JARK01001411    EYC06502.1    CAVP010059404    CDL95787.1    JOJR01000583    RCN36166.1    DS268420    EFO87874.1    JARK01001418    EYC05389.1    JARK01001601    EYB87313.1    JOJR01000015    RCN51257.1    PDUG01000005    PIC23776.1    JARK01001345    EYC27589.1    PDUG01000012    PIC13506.1    JARK01000059    EYC44525.1    DS268747    EFP00909.1    UYSL01019905    VDL71189.1    DS268433    EFO97645.1    DS268612    EFO94085.1    UZAH01026445    VDO80847.1    KN728607    KIH63514.1    JARK01000176    EYC41234.1    UZAH01001595    VDO19836.1    PIC29926.1    DS268565    EFO90304.1    PDUG01000001    PIC51673.1    KN728435    KIH63782.1    DS268492    EFP11674.1    DS268508    EFO83264.1    HE601413    CAS00486.1    DS268466    EFP06959.1    DS268428    EFO94379.1    EFP11689.1    DS268606    EFO93488.1    DS268539    EFO88027.1    UYSL01009772    VDL68385.1    DS268679    EFO98285.1    DS268525    EFO85497.1    UZAH01000669    VDO19161.1    PDUG01000006    PIC20538.1    DS268421    EFO88618.1    DS268673    EFO98001.1    JARK01001658    EYB84158.1    UYSL01022144    VDL79905.1    CAVP010058755    CDL95145.1    JARK01001337    EYC34439.1    PIC28734.1    DS268545    EFO88382.1    UZAH01031030    VDP13493.1    PDUG01000004    PIC32571.1    UYSL01021399    VDL78127.1    JARK01000255    EYC39473.1    PIC53815.1    KX931010    APL98300.1    KN769991    KIH46151.1    HE601187    CAR99265.1   
Pfam
PF00019   TGF_beta        + More
PF00431   CUB
PF16095   COR
PF00069   Pkinase
PF13358   DDE_3
PF00292   PAX
Interpro
IPR009057   Homeobox-like_sf        + More
IPR001839   TGF-b_C       
IPR029034   Cystine-knot_cytokine       
IPR017948   TGFb_CS       
IPR015615   TGF-beta-rel       
IPR000859   CUB_dom       
IPR035914   Sperma_CUB_dom_sf       
IPR032171   COR       
IPR020859   ROC_dom       
IPR000719   Prot_kinase_dom       
IPR011047   Quinoprotein_ADH-like_supfam       
IPR011009   Kinase-like_dom_sf       
IPR008271   Ser/Thr_kinase_AS       
IPR027417   P-loop_NTPase       
IPR038717   Tc1-like_DDE_dom       
IPR001523   Paired_dom       
IPR036388   WH-like_DNA-bd_sf       
SUPFAM
SSF46689   SSF46689        + More
SSF57501   SSF57501       
SSF49854   SSF49854       
SSF56112   SSF56112       
SSF52540   SSF52540       
SSF50998   SSF50998       
Gene 3D
PDB
5CR4     E-value=1.84246e-09,     Score=145

Ontologies

Topology

Subcellular location
Secreted  
Length:
182
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
8.50065000000001
Exp number, first 60 AAs:
8.47838
Total prob of N-in:
0.57393
outside
1  -  182
 
 

Population Genetic Test Statistics

Pi
33.142139
Theta
43.194707
Tajima's D
-0.722296
CLR
0.883016
CSRT
0.193040347982601
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号