SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10066
Pre Gene Modal
BGIBMGA005539
Annotation
putative_chitinase_3_[Papilio_xuthus]
Location in the cell
Cytoplasmic   Reliability : 1.436
 

Sequence

CDS
ATGGCGTATTCATATCGGCCACCGATATTGCTTCGATGGATGCTCACCGTGGTTCTGGTCATAGCTGTCATCGCTCCCACGTCAGACTCAACAACTGTCCGCAGAAGACTCCGGAAGCCATCAAAGGTGTCCACATCGGTTTCGTCCAGCGTCTCTAGATCCACAGATCAAGTTCTCTCAGCTAGCGTGAACAGACCAAAGATTCGTGGTCGTCCTTCAATAGCCAGTAGAAAATCATCCGCGGCTCTGGACAACTCCGTCACCACCGAACATCACAAAGATAAGGATGGATACAAGATCGTCTGCTATTACACCAACTGGTCCCAATACCGGACGAAGGTCGGGAAGTTCGTTCCAGAGGACATTCAGCCCGATCTCTGCACCCACATCATCTTCGCTTTCGGCTGGCTGAAGAAAGGAAAACTGAGCAGCTTCGAATCGAACGATGAGACGAAAGACGGGAAGACAGGACTGTACGACAAGATTAATGGGCTGAAGAAAGGGAATCCTAAACTAAAGACTCTATTGGCCATTGGCGGTTGGTCTTTCGGGACTCAGAAGTTCAAGGACATGGTGGCTACCAGATACGCCCGGCAGACGTTCATCTACTCCGCGATTCCTTACTTGAGGGACAGGAACTTTGACGGGCTCGACATCGACTGGGAATACCCCAAGGGTGGAGACGACAAGAAAAACTACGTGCTCCTGTTGAAAGAGCTCCGTGAGGCCTTCGAAGCGGAGGCTCAAGAAGTGAAGAAACCTCGTTTGCTTCTTACTGCAGCTGTGCCAGTTGGACCTGACAACATCAAGAGCGGATACGACGTTCCTGCTGTAGCCAGCTATCTGGACTTCATCAACCTTATGGCCTACGACTTCCACGGCAAATGGGAGAGGGAGACCGGCCACAACGCCCCGCTGTACGCTCCATCGACAGACTCGGAGTGGAGGAAGCAACTATCAGTAGACCACGCAGCACATCTCTGGGTGAAACTTGGAGCCCCGAAGGACAAACTTATTATTGGTATGCCAACATATGGACGTACATTCACGCTCTCCAACCCTAATAACTTCAAAGTGAACGCGCCGGCCAGTGGTGGAGGAAAAGCGGGAGAGTACACCAAGGAAAGCGGTTTCCTCGCTTACTATGAGGTGTGCGAAATGCTAAGGAACGGGGGTGCCTACGTCTGGGACGATGAAATGAAAGTCCCTTACTGCGTCCACGGGGACCAGTGGGTCGGATTCGACGATGAGAAATCAATCAGGAACAAAATGAGGTGGATCAAAGACAATGGCTTCGGAGGAGCAATGGTGTGGACCGTTGATATGGACGACTTCTCCGGCAACGTCTGCGGCGGCGATGTAAAGTATCCATTGATCGGTGCAATGAGGGAAGAACTCCGAGGTATATCTCGAGGTAAAGACGCCAAAGATGTCGACTGGGCCACGGTTGCTTCCAGCATAGTGATAGAAGAAACTGAGAAACCAGAACCGATACAGGTTCCATTGTCCGAAGTCCTCAAGCGCATCAAGAAGCCTGGTAAAAACGTCATCATAAAGACCAATGGAGCGGCACTTTCAGATAAAAACAAACGCGAGCCCCAAGTACTCTGTTATCTCACATCCTGGTCAGCCAAACGTCCAAGCGCAGGCCGCTTCACACCAGAAAACGTTGACCCCAAACTCTGTACCCACATCATATACGCTTTCGCAACCCTCAAAGACCACAAGCTAGCTGAAGCTGACGACAAAGACGCTGATATGTACGATAAAGTCGTTGCGTTGAGAGAGAAGAACCCCAATTTGAAGATATTGCTCGCCATCGGAGGCTGGGCCTTCGGATCTACTCCGTTCAAAGAATTGACTTCGAACGTGTTCCGCATGAACCAGTTCGTGTATGAAGCCATCGAGTTCCTCCGCGACTATCAGTTCAATGGCTTGGACGTGGATTGGGAATATCCTAGAGGAGCAGATGATCGTGCAGCATTCGTATCTCTGCTCAAGGAATTGCGTCTGGCGTTCGAGGGTGAAGCCAAGACTTCAGGTCAGCCCCGGCTCCTGCTCACTGCTGCTGTACCGGCGTCGTTTGAGGCCATCGCCGCCGGATATGATGTACCGGAAATATCGAAATATTTGGACTTCATAAACGTGATGACGTATGACTTCCACGGCCAGTGGGAGCGCCAGGTCGGCCACAACAGTCCGCTGTTCCCTCTAGAAAGCGCCACGAGCTACCAGAAGAAACTAACTGTGGACTACTCCGCCCGCGAGTGGGTCCGCCAGGGCGCCCCCAAAGAGAAGCTGATGATCGGCATGCCCACGTACGGAAGGTCCTTCACGCTTATCAACGAAACACAGTACGACATCGGCGCTCCGGCTTCAGAGGGCGGAGAAGCCGGACGTTTCACCAACGAAGCCGGCTTCATGTCCTACTACGAAATCTGCGAGTTCCTACGAGAGGACAACACGACGCTCGTCTGGGACAACGAGCAGATGGTGCCATTCGCTTACCGAGGCGACCAGTGGGTCGGGTTCGACGACGAGAGATCGCTTAAAACAAAAATGGCCTGGCTGAAGGAAGAAGGGTTCGGCGGGATCATGGTCTGGTCTGTCGACATGGACGACTTCCGCGGCTCCTGTGGAACTGGCAAGTTCCCGCTCATCACGACCATGAAGCAGGAACTGTCCGACTACAAGGTCAAGCTGGAATACGACGGGCCCTACGAGACGGTGCTCACCAGCGGACAGTACACCACTAAGGACCCCACTGAGGTGACGTGCGAGGAGGAGGACGGCCACATCTCGTACCACAAGGACCAGGCGGACTGCACCATGTACTACATGTGCGAGGGCGAGCGGAAGCACCACATGCCGTGCCCCTCCAACCTCGTGTTCAACCCCAACGAGAACGTCTGCGATTGGCCGGAGAACGTGGAGGGATGCGCGCACCACACGCAGGCGCCGCCCGCCAGACGATAG
Protein
MAYSYRPPILLRWMLTVVLVIAVIAPTSDSTTVRRRLRKPSKVSTSVSSSVSRSTDQVLSASVNRPKIRGRPSIASRKSSAALDNSVTTEHHKDKDGYKIVCYYTNWSQYRTKVGKFVPEDIQPDLCTHIIFAFGWLKKGKLSSFESNDETKDGKTGLYDKINGLKKGNPKLKTLLAIGGWSFGTQKFKDMVATRYARQTFIYSAIPYLRDRNFDGLDIDWEYPKGGDDKKNYVLLLKELREAFEAEAQEVKKPRLLLTAAVPVGPDNIKSGYDVPAVASYLDFINLMAYDFHGKWERETGHNAPLYAPSTDSEWRKQLSVDHAAHLWVKLGAPKDKLIIGMPTYGRTFTLSNPNNFKVNAPASGGGKAGEYTKESGFLAYYEVCEMLRNGGAYVWDDEMKVPYCVHGDQWVGFDDEKSIRNKMRWIKDNGFGGAMVWTVDMDDFSGNVCGGDVKYPLIGAMREELRGISRGKDAKDVDWATVASSIVIEETEKPEPIQVPLSEVLKRIKKPGKNVIIKTNGAALSDKNKREPQVLCYLTSWSAKRPSAGRFTPENVDPKLCTHIIYAFATLKDHKLAEADDKDADMYDKVVALREKNPNLKILLAIGGWAFGSTPFKELTSNVFRMNQFVYEAIEFLRDYQFNGLDVDWEYPRGADDRAAFVSLLKELRLAFEGEAKTSGQPRLLLTAAVPASFEAIAAGYDVPEISKYLDFINVMTYDFHGQWERQVGHNSPLFPLESATSYQKKLTVDYSAREWVRQGAPKEKLMIGMPTYGRSFTLINETQYDIGAPASEGGEAGRFTNEAGFMSYYEICEFLREDNTTLVWDNEQMVPFAYRGDQWVGFDDERSLKTKMAWLKEEGFGGIMVWSVDMDDFRGSCGTGKFPLITTMKQELSDYKVKLEYDGPYETVLTSGQYTTKDPTEVTCEEEDGHISYHKDQADCTMYYMCEGERKHHMPCPSNLVFNPNENVCDWPENVEGCAHHTQAPPARR

Summary

Similarity
Belongs to the glycosyl hydrolase 18 family.
EMBL
KF318218    AGX32025.1    KQ459232    KPJ02577.1    JQ417265    MH899218    + More
AFI55112.1    AZS52294.1    KX668138    ASM94207.1    MG551526    AUF40393.1    JQ653039    AFM38213.1    NWSH01003324    PCG66555.1    KQ461155    KPJ08355.1    NEVH01016331    PNF25507.1    KQ971361    EFA05323.2    DQ659247    ABG47445.1    GEDC01022730    JAS14568.1    KK852804    KDR16263.1    KM217115    AJO25042.1    AAAB01008807    EAA04006.4    DS235164    EEB12743.1    ATLV01011963    KE524742    KFB36184.1    APCN01003668    AXCM01001639    ADMH02001833    ETN60985.1    AXCN02000560    GGMS01002671    MBY71874.1    GFXV01003929    MBW15734.1    DS232225    EDS37897.1    CH477319    EAT43684.1    GFDL01006125    JAV28920.1    GFDL01006140    JAV28905.1    ABLF02038822    KY576032    AUF41626.1    KY030969    ATU82720.1    KT717329    GBHO01037567    GBRD01008704    GDHC01007234    ANC95003.1    JAG06037.1    JAG57117.1    JAQ11395.1    GL445407    EFN89634.1    KQ981805    KYN35631.1    KY274433    AUM84818.1    KQ982431    KYQ56499.1    GL888424    EGI61144.1    KQ981042    KYN10100.1    AJVK01022918    KQ976716    KYM76839.1    GL439470    EFN67257.1    KQ978344    KYM94854.1    ADTU01002189    ADTU01002190    ADTU01002191    ADTU01002192    ADTU01002193    KY290391    ARE59262.1    KQ434850    KZC08569.1    UFQS01001413    UFQT01001413    SSX10758.1    SSX30440.1    ACPB03000970    GBYB01008986    JAG78753.1    KZ288210    PBC32932.1    CVRI01000067    CRL06798.1    GDHF01031421    GDHF01020037    GDHF01003132    GDHF01000620    JAI20893.1    JAI32277.1    JAI49182.1    JAI51694.1    GL771642    EFZ09665.1    KQ435711    KOX79466.1    LBMM01002318    KMQ94993.1    KY681042    AUP42569.1    JRES01000611    KNC29864.1    AAZX01004127    KQ414784    KOC61139.1    CH964161    EDW79976.2    CH902618    EDV39843.2    CH933809    EDW17524.2    KRG05599.1    KRG05600.1    CH954178    EDV50369.1    AE014296    AY051988    AAF47714.3    AAK93412.1    CM000363    CM002912    EDX09013.1    KMY97240.1    GBXI01006425    GBXI01006211    JAD07867.1    JAD08081.1    CH379070    EAL30233.3    CM000159    EDW93860.2    EDW93859.1    OUUW01000002    SPP77414.1    CH940647    EDW68440.2    KB631935    ERL87331.1    APGK01040030    KB740975    ENN76520.1    CH480817    EDW50267.1    JXJN01010374    CP012525    ALC43111.1    PYGN01002248    PSN31011.1    GBGD01000446    JAC88443.1    JXUM01121179    KQ566471    KXJ70105.1    AGBW02006445    OWR55218.1    CH479208    EDW31122.1    GGMR01008525    MBY21144.1   
Pfam
PF01607   CBM_14        + More
PF00704   Glyco_hydro_18
PF00631   G-gamma
Interpro
IPR011583   Chitinase_II        + More
IPR036508   Chitin-bd_dom_sf       
IPR017853   Glycoside_hydrolase_SF       
IPR002557   Chitin-bd_dom       
IPR001579   Glyco_hydro_18_chit_AS       
IPR001223   Glyco_hydro18_cat       
IPR029070   Chitinase_insertion_sf       
IPR015898   G-protein_gamma-like_dom       
IPR036284   GGL_sf       
SUPFAM
SSF57625   SSF57625        + More
SSF51445   SSF51445       
SSF54556   SSF54556       
SSF48670   SSF48670       
Gene 3D
PDB
5WVH     E-value=0,     Score=2413

Ontologies

Topology

SignalP
Position:   1 - 30,         Likelihood:  0.690327
 
 
Length:
991
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
19.18846
Exp number, first 60 AAs:
19.17803
Total prob of N-in:
0.95508
POSSIBLE N-term signal
sequence
inside
1  -  8
TMhelix
9  -  28
outside
29  -  991
 
 

Population Genetic Test Statistics

Pi
237.473692
Theta
170.727482
Tajima's D
1.386464
CLR
0.511255
CSRT
0.75781210939453
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号