SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10062
Annotation
PREDICTED:_uncharacterized_protein_LOC106711352_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.467
 

Sequence

CDS
ATGGAGCAGGTAATGACCGCACTTCTTTCTATTCAAAAAGAACTCGACGAACAGAAAAAACTTATACACAAAAAAGGGGAAGAAGTGACAGAGAACGTAACATTAAATATAAATAAGATACTAGAAGAGAAATTAAAAAATTTGGAAGAAAAACATGAAAACCTGAAGTCGAGGGTGGAAAATCAAGAGCAAAGATTATACTACATGGAGAGACAATCAAGACAACGTAATCTAGTCTTCTTTGGATTGGAGGAACACGATAAATCCTACTCAAATTTAGAAAACACTATAGTAGACTTTGTACATAAATACTTCCCAATACAAATAGACCATAAAGACTTACAAGCGATCAGAAGAATAGGGAAGAGGACTAAAAAGCCACGACCGATAGTTATTACTTTCACAACACTTGGCAAGAAGATAGATATCTTAAAGGGCAAAGGAGCTTTAAAAGAAACACCGTATTATATCAAAGAAGACTACCCTCAATCAGTCTTGCAAAAAAGAAAAGAACTACAGGAGCAAGTTATAGCAGAAAGAGAGAAGGGTAATAAAGCCATTATTAAATACGACAAGCTTGTTCTACTAAATAATTCATCCAAAGACCCGAAAAACAATAAAAGAAATCTATCAGAATCTCCAGAGAATAACACAATCAACCATGCCGAGCAGATATCTCAAGCAAACAAAAAGAACAAAACCTTGGCTGCCCACATAATCCAAAGGTCTTCAAGCTTTTCCGAAGGTGGAGTAAAACCGAGCATACTAAACTATCTAACAAACAAAAATAACAAGAAAATAAACACACAAGCCAACACCACAAATATATAG
Protein
MEQVMTALLSIQKELDEQKKLIHKKGEEVTENVTLNINKILEEKLKNLEEKHENLKSRVENQEQRLYYMERQSRQRNLVFFGLEEHDKSYSNLENTIVDFVHKYFPIQIDHKDLQAIRRIGKRTKKPRPIVITFTTLGKKIDILKGKGALKETPYYIKEDYPQSVLQKRKELQEQVIAEREKGNKAIIKYDKLVLLNNSSKDPKNNKRNLSESPENNTINHAEQISQANKKNKTLAAHIIQRSSSFSEGGVKPSILNYLTNKNNKKINTQANTTNI

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR004244   Transposase_22        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
276
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0006
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01949
outside
1  -  276
 
 

Population Genetic Test Statistics

Pi
2.649641
Theta
17.852319
Tajima's D
-0.860211
CLR
126.829167
CSRT
0.16199190040498
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号