SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10052
Annotation
PREDICTED:_uncharacterized_protein_LOC105391048_[Plutella_xylostella]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Mitochondrial   Reliability : 1.701 Nuclear   Reliability : 2.049
 

Sequence

CDS
ATGTTGGCTAACGGCACCACGCGACCCTCTGAGAGTCCCTGGTCCGCACCACTACACCTCGCTGCTAAAAAGGAGAACGGTTGGCGACCATGCGGCGACTACCGTATGCTAAACGCTCGCACGATACCAGATAAGTATCCGATTCGCCATATCCAAGACTTTGCGCATAGCCTGTCTGGCTGTCGTGTATTTTCTACCATTGACCTGGTTAAAGCTTTTAATCAAATACCGGTTTTTGAAGACGATATACCAAAAACAGCGATAACAACCCCGTTTGGACTCTTTGAATTTCCGTACATGACGTTTGGGTTGCGAAACGCAAGTCAAACTTTTCAGAGGTTTGTCGATGAGATGACACGTGGCTTAGATTTCTGCTTCCCCTATATCGATGATTTTCTCATATTTTCCAGTAATGAATCTGAGCACCTGGAGCACCTACATCAGCTTTTCATCAGAATGAAAGAATATGGAATGCTCATCAACACTGCAAAATGTGTTTTCGGTGCATCGGAGGTGGAATTTCTTGGCTACCATATTGACGCAAATGGAACAAAACCTCTGGAAAGCAAGGTACAAGCCATCAAAGAATTTCCTGTCCCTAAAACAGCTAAGCAGCTTAGAAGATTCTTGGGCATGATAAACTTCTATCGTAGATTTATCCCCAAAGCTGCAAATATTCAAGCTGCTCTAAGCTCCTTGCTGACAGGTTCTATAAAAGCATCACATCCAATTGAGGTGACGGGGGACTCACTAAAGTCATTTGAAGACTGTAAAGAAAGCCTTTGTAACGCAGCTTTACTTGCTCATCCTGACTGTGACGCCAAGGTGAGCTTAGTGACTGATGCGTCTGACTTTGCTATTGGTGGAGTATTACAACAGCTGAAGGACGGAAATTGGCAACCTCTGGCATTCTTCTCTCGTAAGTTAAGCCCATCGCAACAAAAATATTCACCTTACGATCGAGAGCTTTTGGCAATTTACGAGAGCATCAAATACTTCAGGCATTGGTTAGAAGCAACAACTTTTACCATCTATACTGACCATAAACCATTATGCTTCGCATTCCATCAGCGGAAGGCAAACTGTAGTCCACGTCAATATAGACATTTAGACTACATATCACAGTTTTCGACTAACATACAACATATATCCGGAAAAGATAATGTTGTGGCTGACACTCTTTCCCGGGCTGGTCAAGTTGAAGAACTGCAAAATCCTGTCAATCTCGAAACTTTGGCCAAAGCGCAAGATACGGACACTGAACTAGTGAATTTCTTAAGACGGCACACTTCGTTACAACTCGTGAAGCTAAATATACCAGGAAGTCAAAAACAACTGTACTGCGATGTCAGCACGCCGACTCCCAGGCCTCTGGTGCCAAAGCACTTACGGAAACAAATATTTGAAAGCTTGCACTCATTGAGCCATCCCGGTACAAAGGCTAGTGCTAAACTAGTAGCTGAACGATTTGTATGGCCTTCACTCAGGAAAGACTGTCGTGACTGGGCTAGAGCGTGTTTAGCTTGCCAACGCTCAAAAATAAATCGACATGTTAGCTCACCGTTAGGCACCTTCGATTTACCAAAAGCAAGATTCAATCATGTACACCTAGACATCATTGGACCGTTACCTCCTTCCGGTGATTACAAGTACTGTTTAACAGCAATTGATCGTTTTACCCGGTGGACTGAAGCTATACCACTGACTGATATTACGGCCGAATCAGTAGCAAAAGCTTTCTTATCGGGATGGATTGCCCGATTTGGTTGTCCCACTGACATCGTCACTGATCGCGGCAGACAATTTGAATCAGCACTATTCGAACAACTTTCCAAATTCATAGTGTTTAAGCATCGCAAAACTACCAGCTACCATCCTCAATGCAATGGTCTCATTGAAAGGTTTCACCGGCAGCTGAAGGCTGCTATTACATGTCATGCCGACATCAACTGGACCGAAACTTTACCAATCGTGCTCCTCGGCATAAGAAGTGCTTTTAAGGAAGACATTCAGTGCTCGTCAGCCGAATTACTATATGGTGAACCCCTGCGCCTACCAGGAGAATTTTTTGGTCATAAAACTGACAAGCAAGATACGGATATAACTGATTTTTCAGCCCGCATCAGGTCATTTGCCAGCAATTTACAGCCAGTCCCAACATCACATCATTCTACCCAGAAGATATTTATCTACAAAGATCTTGCATCTTGCTCGCACGTATTCCTCAGAGAAGACGGAGTCAAACGTGGATTTCAACCAGCGTATAAAGGCCCCTACAAAGTTATTAACAGAGACAACAAAGTGTACAAGCTGTTAATAAACGGAAAAGAGATCAACGTTTCCATAGACAGGATCAAACCAGCTTACTTATTAGATAGCAACACAGAAAAAATACCTAAGCAACTCTATGATGAAAAAGAAAGTCTGGAATCGCCGCGCTCATCTCACAGAACAAGATCGGGTAGAAAGGTCACGTTTCCAGATTACTATCGCCCATCCTGA
Protein
MLANGTTRPSESPWSAPLHLAAKKENGWRPCGDYRMLNARTIPDKYPIRHIQDFAHSLSGCRVFSTIDLVKAFNQIPVFEDDIPKTAITTPFGLFEFPYMTFGLRNASQTFQRFVDEMTRGLDFCFPYIDDFLIFSSNESEHLEHLHQLFIRMKEYGMLINTAKCVFGASEVEFLGYHIDANGTKPLESKVQAIKEFPVPKTAKQLRRFLGMINFYRRFIPKAANIQAALSSLLTGSIKASHPIEVTGDSLKSFEDCKESLCNAALLAHPDCDAKVSLVTDASDFAIGGVLQQLKDGNWQPLAFFSRKLSPSQQKYSPYDRELLAIYESIKYFRHWLEATTFTIYTDHKPLCFAFHQRKANCSPRQYRHLDYISQFSTNIQHISGKDNVVADTLSRAGQVEELQNPVNLETLAKAQDTDTELVNFLRRHTSLQLVKLNIPGSQKQLYCDVSTPTPRPLVPKHLRKQIFESLHSLSHPGTKASAKLVAERFVWPSLRKDCRDWARACLACQRSKINRHVSSPLGTFDLPKARFNHVHLDIIGPLPPSGDYKYCLTAIDRFTRWTEAIPLTDITAESVAKAFLSGWIARFGCPTDIVTDRGRQFESALFEQLSKFIVFKHRKTTSYHPQCNGLIERFHRQLKAAITCHADINWTETLPIVLLGIRSAFKEDIQCSSAELLYGEPLRLPGEFFGHKTDKQDTDITDFSARIRSFASNLQPVPTSHHSTQKIFIYKDLASCSHVFLREDGVKRGFQPAYKGPYKVINRDNKVYKLLINGKEINVSIDRIKPAYLLDSNTEKIPKQLYDEKESLESPRSSHRTRSGRKVTFPDYYRPS

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
LBMM01013040    KMQ85849.1    LBMM01012479    KMQ86204.1    LBMM01009142    KMQ88359.1    + More
LBMM01013103    KMQ85815.1    LBMM01012030    KMQ86466.1    GEZM01017686    JAV90495.1    LBMM01006500    KMQ90563.1    LBMM01012134    KMQ86388.1    KL367492    KFD69854.1    GEGO01003687    JAR91717.1    GBXI01015889    JAC98402.1    AAGJ04130731    EF426679    ABP48077.1    GBXI01003773    JAD10519.1    GFDL01003994    JAV31051.1    KQ971355    EFA07205.2    GEZM01036621    JAV82565.1    AAGJ04001742    LBMM01012160    KMQ86374.1    LN877232    CTR11708.1    GBXI01017046    JAC97245.1    MRZV01001828    PIK35719.1    KL367552    KFD64647.1    KL363241    KFD51254.1    GEGO01003506    JAR91898.1    IAAA01033850    LAA08869.1    GEGO01001281    JAR94123.1    KL367555    KFD64489.1    GEGO01004649    JAR90755.1    MRZV01001127    MRZV01000556    PIK40396.1    PIK47817.1    GFPF01012375    MAA23521.1    KQ973093    EFA13472.2    BK004070    DAA04500.1    GEDC01031421    JAS05877.1    GEGO01004475    JAR90929.1    LBMM01012567    KMQ86146.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    CABG01000050    CAZ37786.2    LBMM01001181    KMQ96765.1    GGFK01003401    MBW36722.1    GGLE01001814    MBY05940.1    KL367544    KFD65142.1    IAAA01040175    LAA10459.1    GGFK01003442    MBW36763.1    KL367778    KFD59660.1    BK004066    DAA04495.1    KL367664    KFD60497.1    BN000802    CAJ00250.1    KL367655    KFD60653.1    ABLF02030693    ABLF02030697    KL367543    KFD65158.1    GEGO01000286    JAR95118.1    GDHF01001116    JAI51198.1    GDHF01014424    JAI37890.1    GDHF01021808    JAI30506.1    GEDV01001796    JAP86761.1    GEGO01004484    JAR90920.1    GDKW01003376    JAI53219.1    GEGO01004686    JAR90718.1    JYDT01000067    KRY86703.1    JYDU01000460    KRX86127.1    DF142933    GAA49140.1    GGLE01003443    MBY07569.1    LBMM01012633    KMQ86092.1    AAGJ04112098    JYDR01000002    KRY79251.1    GACK01008900    JAA56134.1    KL367479    KFD72009.1    JYDO01000387    KRZ65366.1    GGMR01010038    MBY22657.1    GBYB01009311    JAG79078.1    CABG01000001    CCD58591.1    AAGJ04000250    BN000785    CAJ00226.1    JYDK01000306    KRX70098.1    KL367519    KFD67051.1    JYDL01000255    KRX12868.1    JYDW01000445    KRZ48221.1    JYDK01000002    KRX85197.1    JYDH01000101    KRY32299.1    AAGJ04172791    GEDV01008182    JAP80375.1    GEGO01004569    JAR90835.1    AY013565    AAK07486.1    AY013563    AAK07485.1    LBMM01011855    KMQ86587.1    FN356212    CAX83701.1    AY013569    AAK07487.1    FN356213    CAX83702.1    GAKP01008886    JAC50066.1    GFPF01010655    MAA21801.1    JYDJ01000353    KRX36608.1    NIVC01003188    PAA52757.1    KL363454    KFD45607.1    QPMK01000035    RDD64024.1    KL363417    KFD45845.1    GBHO01015475    JAG28129.1   
Pfam
PF00665   rve        + More
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF17917   RT_RNaseH
PF01087   GalP_UDP_transf
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR034132   RP_Saci-like       
IPR001969   Aspartic_peptidase_AS       
IPR041373   RT_RNaseH       
IPR013032   EGF-like_CS       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF52540   SSF52540       
SSF48371   SSF48371       
PDB
4OL8     E-value=2.65645e-70,     Score=677

Ontologies

Topology

Length:
833
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01175
Exp number, first 60 AAs:
9e-05
Total prob of N-in:
0.00056
outside
1  -  833
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.027076
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号