SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10026
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.486
 

Sequence

CDS
ATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGATCATCGAAACAAGTTGCAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCGTCGATCCGCGCCTACGATAGGTATCCTACCGTGGATAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAAGACTCGCGCCCTCCCAAAGGTCTTACTACAGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTACTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTAGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAGCCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGATCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAATCTGGCACAATGGTTTGACTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGTACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCACAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCTCACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCAGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGAGCAGGCTTAGGGACCCCGGTACCCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVAAEDFLHRFKLPDDIRELLRAKNASIRAYDRYPTVDNRIRMRALQRDVKSRIAEVRDARWSDFLERLAPSQRSYYSLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLIYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKIWHNGLTFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSSRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRSRLRDPGTRTRRTRQRGRRAT

Summary

EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GGMR01019198    MBY31817.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02042518    ABLF02057746    GGMS01006359    MBY75562.1    GGMS01002955    MBY72158.1    GGMR01018716    MBY31335.1    GFXV01007093    MBW18898.1    GBBI01004395    JAC14317.1    ABLF02008463    GGMS01000737    MBY69940.1    ABLF02033757    GFTR01008038    JAW08388.1    GGMR01003407    MBY16026.1    RPOV01000134    RPJ78669.1    NEVH01006736    PNF36716.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMS01008766    MBY77969.1    GBBI01001646    JAC17066.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMS01017914    MBY87117.1    GEZM01053022    JAV74219.1    S59870    AAB26437.2    GGMR01000676    MBY13295.1    ABLF02024246    ABLF02034467    GFTR01008262    JAW08164.1    ABLF02021177    ABLF02027367    ABLF02066338    NEVH01000269    PNF43694.1    NEVH01020940    PNF20481.1    GEZM01084969    JAV60363.1    GBBI01004571    JAC14141.1    GEZM01038405    JAV81653.1    GFDF01007661    JAV06423.1    GGFJ01001858    MBW50999.1    GGFJ01001857    MBW50998.1    NEVH01017542    PNF24034.1    NEVH01003017    PNF40781.1    NEVH01023962    PNF17612.1    NEVH01022639    PNF18527.1    NEVH01018383    PNF23463.1    NEVH01006721    PNF37225.1    NEVH01007443    PNF35684.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01020071    PNF21969.1    GGMS01017365    MBY86568.1    NEVH01010546    PNF32261.1    NEVH01026386    PNF14434.1    GFTR01008151    JAW08275.1    GGMS01002992    MBY72195.1    GFTR01008256    JAW08170.1    GFTR01008251    JAW08175.1    NWSH01000032    PCG80496.1    GFTR01008271    JAW08155.1    ABLF02037660    NEVH01005938    PNF38077.1    ABLF02028535    ABLF02028545    NEVH01023961    PNF17613.1    ABLF02020655    ABLF02039168    ABLF02061060    NEVH01001355    PNF42855.1    NEVH01002704    PNF41489.1    PCG80497.1    GFTR01008246    JAW08180.1    GFXV01002840    MBW14645.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01007838    PNF34986.1    NEVH01014858    PNF27387.1    ABLF02041767    NEVH01002716    PNF41415.1    NEVH01000280    PNF43672.1    NEVH01019964    PNF22161.1    NEVH01021205    PNF19912.1    NEVH01016302    PNF25823.1    NEVH01011193    PNF32021.1    NEVH01006754    PNF36554.1    GGMR01012305    MBY24924.1    GEZM01074951    JAV64378.1    GBGD01000880    JAC88009.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
736
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.88439
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04084
outside
1  -  736
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
3.687514
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号