SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10011
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 1.264 Nuclear   Reliability : 1.089
 

Sequence

CDS
ATGATGGCAAACTTAAAACAAAAATTACCCCAGGAGGGTACCACCTTAGGTGGAGAATCCCTCCGTGCTTCCACCTCGGTGGGAGCACGCTGCCCCGCGTATTCTGGGGGGGGCAAAGAATGCCATGATGAAGGGGGCTGTGCGACGGGTAGCGGAAAACCCGTCGAACCGAGGTGTGCCAGCGCTGGCTCGACGCGCTCTGCGCTCGTCAGCGACGGCGAGGCAGTTGATCCAAAAGGGACAACCGCCAAGAAGATCAGGCGGAAGAGGAAGTCGTGGCGAGTTTCCTCTCGTGAGGGGGTAGGGGAGCCAGCGTCGTCCTCTGGTGCGGATGCCCCACCGGAGAAAGTGCTGGTAGTCTCCGAAGCGGCCTCTGCTGCGGAGGAGATGCCGCCCCCTAAAGGGAGACCCGCCCGTAGAAGAGGCGCACCGTCACCGGCACCATCATCAGTGTCGATGTCTGTCGCTTCACTAGACGGGCAGACGACGGAGGAGGAAGAGGGTGGTCTTCAGGACCCTGCCTTGGTCATAGACAGGGCCATGAAGACCATCAAATCATATGCGGCCAACGGCACCAAAACCAAAGCCACTGGCCGAAAACTGCGAGATGTGGTCTCGCAGGTCTCGAAGGTTCTGCCTTCGGTTGCTTCTGCCAATGACCAGGTAGTACAGCTGATGGCGGAAAATTCGAGGCTTCGAGCACAGCTCCAAGCACAGCAGCAACCCAATGACGGCGCAGCGACGCATTGGGCCACTGGAGCCCCTCGGGGCCCCCGTCCCCCGGCGCTGACTGGCGACCGATGGCCTGTGCTGCCACCACCGCATGTGGCACAACAGCGGCCGCGTCTCCCGTCACCGCGCTCTAGGGAGACGTCCGCCGCCGAGCGACGGCGGGCACTCGCAGGGCCACGGATGTTGGCTCCGCCAGAACCAGCAAACTTCAGCCTGGACGAGGTCATCAGCCGCACTGTCCAGGCTGTAATAGAAAGGCTGGGCGGCAGGTTGGCAGCTCTCGAGGCGAAAGTCTCGGTCTTGGCTGACACTAGGCGGCTGGCGGTGTCGGGTGCTTTGGCCGCTCGTCCTGCTCCCGTACGAGCTCCGACCACCAAGTCGGGCCCGGGACGGGCTAAAACTAAGCGAGGGGGTGGCGCTAACGCGAATCCTCTACAACAAGCACCCCAGTCCTGTCCACTGCCTCCGCCTCCGTCAAATATGGACGAGGGGTGGAACGTGGTGGCCCGGCGGGGCACCAGAAAGGCCCCACCGGCAGCTCCTCAAATGGGTAGAGCGCCGGCGGCCAAGGCGGCTCAAGCTGCACCCCAACAGGCCGCTGAAGCCAAGGGCATGACATACAGAGATGTCATCGCCCGGGCGCGTGCGGCAGTTGACCTGGGCGAGATTGGGGCGGAGGAGGGCCTCCGCTGCAGGCAGACGGCCAACGGGGCTAAGCTGCTAGAATGTCCCGTTGCCGATAGTGCCGGCATCGCGGAGCGTCTGGTGGCGAAGCTCCGTATGGTCCTACCTGAGGAGGAGGTGCGGGTGCACAGGCCGGTGAAAATGGCCGAATTAAGAGTAACCGGCCTGGACGACTGTACCACCAGGGATGAGGTGATGGCGGCTGTCGCTGTCCAGGGCAAATGCGCACTGGAAAATGTAACCGTAGGCGAGCCGCGCCGCGGTTATACCGGGGCCAGCTCGGTGTGGGTGCGTTGCCCGGTGGAGGCGGCCGCCTCCCTGGCTGCTCCCCCGCCCGGGAGACCATCAGGAAATTCGGGCATACTGCGCGTGGGCTGGATAGCGGCCCACGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGACATGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGACGATGGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGACGATCCCCCCCTTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAATAGGCCTACTGTCGAGTTCGGGCATTTCCTGGACGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTATCGGAGAGGTGGGCGAACGTGGCCGGCCTCTATTTGTTGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCGAGCCCGGCCATCGCGCGCCTTATTCGCGACTGGAGGGTTCTGGAGGGGGCGGAGACGCTGTCAGATCACCGGTATATTCGATTTGATCTCTCCGCCCGCTCCACAGTCGCGGTCGCCTACGGGGACCACCCCCGTGGTGCATCCCGGTCATTCCCCAGGTGGGCACTGAAGCGCTTGAATATGGCGCTACTGATGGAAGCTTCTACGGCGGCGTGGGCGCCCATGCGTCCACATCCAGTTGAGGTCGAGGACGAAGCGGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGACGTGTCGATGCCCCGGATTAGCCCTCGACCTCCCAATCGCCAAGTGTACTGGTGGTCGGCCGAAATCGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGTGCCAGTGCGCGAGGCATCGCCGCCGTCGCCTGCCGCGGCGCAACGATCCGGTGGCGTTCGCGGTGGTAGAGGCCCAGCTGTACGGCGCATTTCGCGTCGCACAGAGGGCGTTGCAGCTGGCCATCAGAAGAGCCAAGGACCAACACATGGAGGGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGAGACCCTATCACATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCAATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCAGGGGGGATTTGTCGCTCCCGCTATGGGCGCGCCGCCGGAATACGACGGCGACGCCCCTGCTGAGGTGCCCCATATAACAGGGGCGGAGCTCCGTGTGGCAGTACGCAAAATGTGCGCAAAGGACACTGCACCTGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGGCTTTATAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTTGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTATCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAACTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGCTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTGGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTGCGGGGGTGGGGTGGCCTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAAAGACACGGAGTGCCCCTCTACCTTCGCCGGCTGGTCGGCTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGGTCGTGCATCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTACTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTAAGCGTAATTTGTTACGCAGACGACACGCTGGTCGTGGCCCGGGGAGGGAGCTTTGCTGAGTCTGCTCGTCTTGCCACCGCTGGGGTAGCGCATGTCGTTGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATCGGGGTCGGGGTGCAGTTAAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCATTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTTCCCAACATCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGGTCAATGGCCTTATACGGGGCACCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTAACCTTCGTGCCCAGGGCGTGGCGCGTCCCAGCCCCAGTGTAGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGGCGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGATTCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGGGTGTTACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGACGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MMANLKQKLPQEGTTLGGESLRASTSVGARCPAYSGGGKECHDEGGCATGSGKPVEPRCASAGSTRSALVSDGEAVDPKGTTAKKIRRKRKSWRVSSREGVGEPASSSGADAPPEKVLVVSEAASAAEEMPPPKGRPARRRGAPSPAPSSVSMSVASLDGQTTEEEEGGLQDPALVIDRAMKTIKSYAANGTKTKATGRKLRDVVSQVSKVLPSVASANDQVVQLMAENSRLRAQLQAQQQPNDGAATHWATGAPRGPRPPALTGDRWPVLPPPHVAQQRPRLPSPRSRETSAAERRRALAGPRMLAPPEPANFSLDEVISRTVQAVIERLGGRLAALEAKVSVLADTRRLAVSGALAARPAPVRAPTTKSGPGRAKTKRGGGANANPLQQAPQSCPLPPPPSNMDEGWNVVARRGTRKAPPAAPQMGRAPAAKAAQAAPQQAAEAKGMTYRDVIARARAAVDLGEIGAEEGLRCRQTANGAKLLECPVADSAGIAERLVAKLRMVLPEEEVRVHRPVKMAELRVTGLDDCTTRDEVMAAVAVQGKCALENVTVGEPRRGYTGASSVWVRCPVEAAASLAAPPPGRPSGNSGILRVGWIAAHDMLSQSMAEWSIDMAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDATIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLDGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLSERWANVAGLYLLNRGSVATCVRWQGESIVDVTFASPAIARLIRDWRVLEGAETLSDHRYIRFDLSARSTVAVAYGDHPRGASRSFPRWALKRLNMALLMEASTAAWAPMRPHPVEVEDEAGWFRDTMRRICDVSMPRISPRPPNRQVYWWSAEIAQLRVECVRARCQCARHRRRRLPRRNDPVAFAVVEAQLYGAFRVAQRALQLAIRRAKDQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEQGGFVAPAMGAPPEYDGDAPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLLGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVCGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPLYLRRLVGSYLEDRSVTCTGHGGVVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRLLGVAGALSRLLPNIGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRANLRAQGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPILVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAGCYHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLDDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=1.0585e-11,     Score=175

Ontologies

GO

Topology

Length:
1642
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14517
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1642
 
 

Population Genetic Test Statistics

Pi
145.085903
Theta
115.897686
Tajima's D
0
CLR
0.448096
CSRT
0.367431628418579
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号