SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10005
Annotation
PREDICTED:_retrovirus-related_Pol_polyprotein_from_transposon_TNT_1-94_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.238 Extracellular   Reliability : 1.125 Mitochondrial   Reliability : 1.341
 

Sequence

CDS
ATGGGCCCAAATATGTTTAATTTAGAAAAACTGGTAGGAAGAGAAAACTTTGCCACGTGGAAATTCAGCATGAAAGCATATTTGGAACATGAAGACTTGTGGTGTTGTGTCGAATGCCACGACGGCAAGCCGGTGGATGCTGTAAAGGATATCAAAGCGAAATCAAAGCTGATCTTACTACTGGATCCGCAAAATTATGTCCATGTTCAAGACTGTAAAACCGTCAAACAAGTGTGGGAAAATTTGCAAAAGGCATTTGATGATAATGGTTTAACAAGAAGGGTAGGTTTGCTTAAAGATTTGATCAACACCACATTAGATTCAAGTAACAGAGTTGAAGATTACGTAAGTAAAATAATGAACACAGCACACAAGTTACGTAATATTAGTTTTGATGTCAATGATGAGTGGCTTGGCACCTTGATGTTGGCTGGCTTACCAGAAGAATACAAACCCATGATTATGGGCTTAGAGAGCTCTGGCATTAAAATAAGTGCTGATTCAGTAAAATCTAAACTTATACAAGAAGTTAATACATCAAAATCAGCAGCCTTCTATACAAATTCCAGAAAACCCAGAAATAATACCTCATCGATAAAAACAAAGGGTCCGAGATGCTTTAACTGCAATAGGAATGGACATTTCGCTAAATATTGTAAACTACCAAAGAAACAAACGGCAAATAAAGGAGAAAGTACTAGTTTTGTGGCAGCTTTTTCAGCTACAGTCAGCAAAAATGTAAGTAATGAATGGTACATTGACTCTGGTGCATCCATGCATATGACAAGCAGAATTGATTGGATGTATAATGTAACTGAATCATCTGTAAAAAACATCACTGTGGCTAACAGAGAACCCTTAGCTGTGAATGGAGTTGGCTGTGTGAACATTCAGCTAAGTCAAGAAAATAAAATACAAGTTAAAAATGTTTTATTTGTACCTGGGCTGGCTACTAATCTTCTCTCAGTTGGAGCTATTGTGAAAAATGGATATAAGGTCACATTTAATGACAAAGGATGTGAAGTTGGAAATAGTAAAGGTGAAGTAATATGCTCTGCAAAGCTGAAGAATAGTTTGTATGTATTAGAGACCTGTAAGGAAGTGGCCCACTTGGTCTCAAGAAATAAGAATAGCAATAATACTTACCTGTGGCACCTGCGGATGGGTCATTTGAATATGTCTGATGTAAAGAAGCTACCTACATGCTCTGAGGGAGTGACTCTTATTCCAGATGTAAATGATGTCACTTGCACACATTGTATGGAAGGTAAGCAAGCTAGGTTACCTTTTAAAAATACTGGAACAAGAGCTACGAGACCTCTAGAATTAATCCATTCTGACTTGTGTGGTCCTATGGAGAACATTTCATTTGGAGGATTTTAA
Protein
MGPNMFNLEKLVGRENFATWKFSMKAYLEHEDLWCCVECHDGKPVDAVKDIKAKSKLILLLDPQNYVHVQDCKTVKQVWENLQKAFDDNGLTRRVGLLKDLINTTLDSSNRVEDYVSKIMNTAHKLRNISFDVNDEWLGTLMLAGLPEEYKPMIMGLESSGIKISADSVKSKLIQEVNTSKSAAFYTNSRKPRNNTSSIKTKGPRCFNCNRNGHFAKYCKLPKKQTANKGESTSFVAAFSATVSKNVSNEWYIDSGASMHMTSRIDWMYNVTESSVKNITVANREPLAVNGVGCVNIQLSQENKIQVKNVLFVPGLATNLLSVGAIVKNGYKVTFNDKGCEVGNSKGEVICSAKLKNSLYVLETCKEVAHLVSRNKNSNNTYLWHLRMGHLNMSDVKKLPTCSEGVTLIPDVNDVTCTHCMEGKQARLPFKNTGTRATRPLELIHSDLCGPMENISFGGF

Summary

EMBL
NWSH01000816    PCG74073.1    NWSH01002292    PCG68657.1    PCG68658.1    KQ459875    + More
KPJ19636.1    KQ460297    KPJ16236.1    GEZM01045162    JAV77889.1    BABH01019436    JXUM01099713    KQ564513    KXJ72145.1    LBMM01009660    KMQ87962.1    LBMM01010768    KMQ87255.1    LBMM01004924    KMQ91985.1    LBMM01010791    KMQ87231.1    GEZM01011858    GEZM01011854    JAV93389.1    GEZM01011856    JAV93393.1    GEZM01011857    JAV93390.1    GFTR01008662    JAW07764.1    GBHO01003629    JAG39975.1    GANO01000510    JAB59361.1    GANO01000659    JAB59212.1    GANO01000660    JAB59211.1    GEDC01002834    JAS34464.1    GBHO01026223    JAG17381.1    GEHC01000989    JAV46656.1    GEHC01000988    JAV46657.1    GBHO01003630    JAG39974.1    GBHO01026221    JAG17383.1    AGBW02009826    OWR49812.1    LBMM01010129    KMQ87655.1    GEHC01000991    JAV46654.1    GEHC01000990    JAV46655.1    GEHC01000868    JAV46777.1    GEHC01000867    JAV46778.1    GBHO01020706    JAG22898.1    GBHO01011901    JAG31703.1    GBHO01033237    JAG10367.1    GBHO01033235    JAG10369.1    KQ460882    KPJ11482.1    QOIP01000004    RLU23300.1    LBMM01019465    KMQ83527.1    GBXI01011094    JAD03198.1    KQ460208    KPJ16606.1    LBMM01017716    KMQ83988.1    GDHC01012180    JAQ06449.1    GAKP01015352    JAC43600.1    KL367628    KFD61291.1    JYDJ01001086    KRX32699.1    GDQN01004560    JAT86494.1    JYDJ01000877    KRX33198.1    JYDT01000069    KRY86576.1    KL367553    KFD64618.1    JYDH01000330    KRY26802.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    JYDR01000001    KRY80095.1    JYDJ01000808    KRX33413.1    JYDK01000071    KRX78123.1    JYDJ01000136    KRX42725.1    JYDU01000010    KRY00136.1    GBHO01036544    JAG07060.1    LBMM01013295    KMQ85718.1    AAZX01000798    NEVH01019375    PNF22597.1    NEVH01002725    PNF41351.1    NEVH01006721    PNF37230.1    KZ149913    PZC78057.1    KRX78146.1    NEVH01006980    PNF36330.1    JYDQ01000379    KRY07987.1    ODYU01011515    SOQ57290.1    GALX01001351    JAB67115.1    GBHO01011746    GBHO01011744    GBHO01011742    JAG31858.1    JAG31860.1    JAG31862.1    LVZM01023578    OUC39908.1    GEZM01013472    GEZM01013471    GEZM01013470    JAV92539.1    GL436933    EFN71322.1    JYDL01000021    KRX23821.1    JYDW01000017    KRZ61510.1    GDHF01030254    JAI22060.1    JYDN01000113    KRX56900.1    JYDM01000185    KRZ84108.1    JYDP01000350    KRZ01021.1    LBMM01008124    KMQ89126.1    GBHO01036148    JAG07456.1    GBHO01036147    JAG07457.1    JYDT01000024    KRY90099.1    GBXI01002679    JAD11613.1    CM007899    OTG12557.1   
Pfam
PF07727   RVT_2        + More
PF13961   DUF4219
PF00665   rve
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF00078   RVT_1
Interpro
IPR001584   Integrase_cat-core        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR013103   RVT_2       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR036397   RNaseH_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR000477   RT_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
460
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.15409
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00262
outside
1  -  460
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号