SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09995
Pre Gene Modal
BGIBMGA006890
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_isoform_X1_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.821
 

Sequence

CDS
ATGGCAACAAATAACAACGAAGCAGTCTCCGGTATTAAACCACCCGGATACTTGCACATCGAGTCGGACAACAAGTCGGCAAATTGGAAAAAATGGCGACAACAGTTCGAATGGTATGCAACTGCAATTCAGCTAGGAAAGAAACCTGCCGATATTCAAGCTGCAACATTCATGTCAATCATAGGACCAGATGCAATTGACATCTACAACAGTTTTAATTTGAATACAATAGATGAACAAAAATTAAGCACCATTATCGGAAAGTTCGAAGAATATTTCGCGCCGAAAAACAACATATCGTTCGAAAGGTATGTTTTCTTCAAAATTGAACAACATGAAGACGAATCGTTTAACGAATTCATCACTAGAATTAAAACACAAGCAAACAAATGCGAGTTTGGCACTCTACTTGAAGAAATGCTGAAAGACAAGATTGTATTCGGAATAAAATCAACCCAAATCAGAGAAAAATTACTCACCGAAGAAAAACTTGATCTCACAAAAGCCACAGCCATCTGTAAAAGCAGTGAACAAGCCTCCAAACAACTTAACGAGTTTGAGAATAACAACAAGAGTGAAAAAATACTGACAATCAAAAGTAAGAACTTCAGAAATGAAAAATTTGACTGTAAAAGATGTGGTTCAAACCACAAGGCTAGAGAATGCCAAGCCTACAACAAATTATGTACAAAGTGTAACAAGGCCGGTCATTTTGCAAAAATGTGTCGTTCCCAAATCCAATTGAAACAAAAAAATAAAATAAATACTCTAGAAGAAAATTCTACTTCAGAAAATTCAGATGAATCATTTATAGGACAATTAAGTGTCGGCAACTCCAAAGACTGGACAGAAAGTGTCGAAACTGCCAACACCAAATTCACAGCAAAGCTTGATACTGGTGCAGAGTGCAACGTCCTTCCAAATTTCATAGTACAGAAAACTCACGCTTGTATACAACCAAGTCGCACTAAAAATTTAATAAGCTATTCAAATAACAGAATTTCAGTACTTGGAGAAGTAAAGTTACAATGCAAAATAAAAAAGAAAACTGCTAAAATACTATTTAAAGTTGTAGCTGAAAGAGTCACACCAGTCTTAGGACTAAACACTTGTGAGAAGCTGGAACTAATTGCACGAGTTGAAACATTGAAAGAAAGCTCATCCAACGATGACATATTTAAAGGGTTAGGTTGCTACAAAAATTTTGAGTATGATATTGACCTCATAGAAAACCCCAAATTTGAAATAAAACCAACAAGAAAAGTTCCACATGCCATAAGAAATGAAGTAAAACAAGAATTAGATAGAATGGTAAAACTGGATGTCATCACACCTGAAACAGAACCGACACCAGCAAAGGAAGAGCTACAGAAAACGGTCAAAGAAGTAATAGAGACATTGAAAATTTCTGGCTTCAAACTCAATCAAAGCAAATGCATCTTTGAAGCCAAAAGAATAAAATTTTTAGGTCATATAGTCTCAGCCAAAGGTTTAGAAGCAGATCCTGAAAAAGTAAAAGCCATAGAATTTATGAAAACACCACAGAACAAAAAAGAACTGCAAAGGATACTAGGAATGATAACATATGTAAATAAATACATTCCCAACATGTCAGAATTAACAAACCCTTTAAGAGACCTACTTCACAAGGACACAAGTTTCAACTGGGAATTCTATCATGATGAAGCACTCAACAAAATTAAAAAAGTCTTACAGAATCCACCAGTGCTAAAACTATATGATGTAAACAAACCAGTCACACTAAGCGTGGATGCAAGCTCAAAGAATCTTGGTGCAGCACTTCTTCAGGAAGGCCAACCAGTAGCTTATGGAGCCAGAACATTGACTAAATCCGAACAAAATTATCCTCAAATTGAAAAGGAAGCACTTGCTATACTATTTGGGTGCAAAAAGTTCCATGAGTATGTCTATGGCAAAGAGTTATTAGTCGAATCAGATCACAAGCCGCTCGAGACAATATTCAGAAAAAACATTCAGTCAGCCCCAGCTAGACTTCAACGTATAATGCTCAACCTAACACCGTATTCACCAAAAATTACATTTAAAAAAGGCACAGAAATACCACTAGCAGACTTTTTAAGTCGTGATTGTGACACTTCAAAACTGAATGACTATCAGGAAGAAGACCTAAAGATCTCAATAATATTACCAACAACATTTGACTACACAGAAGAGTTGATCAAAGCAACAAAAGAAGACCCCCACCTGCAACTCTTGTTAAAAACAATAATGAAAGGGTTCCCAGAAAAGGCTGATCAACTCCCTACAGAACTGCATCACTACTTCAATTTCAAAGAAGAACTAACATACTTCAAAGGTCTAATTTTCAAAGGTCACAAAATTGTAGTGCCCAAAACACAAATACCTCAGATGCTAAAATACATACACCAAGGTCACCTTGGAATTCAGAGTTGCTTGAAAAGAGCACACCAATTACTCTATTGGAGAGGACAATATGAAGACATCGTGAAACTGAAAGAATGGCGTTTCACGCACTCAACATCCAGTCCTCACCACCCCCAAGGCAATGGCTTAGCCGAAAGAGCTGTCCAAACTGCAAAAAACCTACTAAGGAAATGCAGTATTGATAAATCGGATATCCAACTTGCTCTATTAAATTGGAGAAATACACCAAGAACAAACAATCTAGGGTCTCCTAATCAACGCCTCTACAGTAGAATAACACGATCACTAATACCTACAAGTGAAAATAATCTTAAACCAAAGATAGTTCAAGGGGTCACATCTGAACTAAAGTACCTACGAAACAAACAAGCCAACCATAGCAACAAGCAACGTAAGGAGCCAACCAATTATGAACTCGACGACAGAATCAGACACAAAGTCGGTCATCGTCAATGGGAAGGAGCGAGAGTGATAGAGAAACCTAATGATCACCCGAGATCCATTATCATTAAAACCGACAAAGGACAAATATTCAGAAGAAACATTGGACACATACACAATACACTATCAGACCTATCAATTGGCAGCAAAGAAGCGGTTCCGGAAACAGTATATCCTGACGACTTACCACATGCCCAATCGGACAAACAACCGGAGCTACCTGCAGCAGCTACTACATCTCAAGAACAAACAACTACATCACCAAGGATTAATTGCAAAAGCAGCGCTTCAGAAGCACCCGTCATAACTAGCAGTGATCAACCGACTACAAGATGTTCAAGATTCGGAAGAACCATCAAACCAGTCGACAGACTAGATCTATAG
Protein
MATNNNEAVSGIKPPGYLHIESDNKSANWKKWRQQFEWYATAIQLGKKPADIQAATFMSIIGPDAIDIYNSFNLNTIDEQKLSTIIGKFEEYFAPKNNISFERYVFFKIEQHEDESFNEFITRIKTQANKCEFGTLLEEMLKDKIVFGIKSTQIREKLLTEEKLDLTKATAICKSSEQASKQLNEFENNNKSEKILTIKSKNFRNEKFDCKRCGSNHKARECQAYNKLCTKCNKAGHFAKMCRSQIQLKQKNKINTLEENSTSENSDESFIGQLSVGNSKDWTESVETANTKFTAKLDTGAECNVLPNFIVQKTHACIQPSRTKNLISYSNNRISVLGEVKLQCKIKKKTAKILFKVVAERVTPVLGLNTCEKLELIARVETLKESSSNDDIFKGLGCYKNFEYDIDLIENPKFEIKPTRKVPHAIRNEVKQELDRMVKLDVITPETEPTPAKEELQKTVKEVIETLKISGFKLNQSKCIFEAKRIKFLGHIVSAKGLEADPEKVKAIEFMKTPQNKKELQRILGMITYVNKYIPNMSELTNPLRDLLHKDTSFNWEFYHDEALNKIKKVLQNPPVLKLYDVNKPVTLSVDASSKNLGAALLQEGQPVAYGARTLTKSEQNYPQIEKEALAILFGCKKFHEYVYGKELLVESDHKPLETIFRKNIQSAPARLQRIMLNLTPYSPKITFKKGTEIPLADFLSRDCDTSKLNDYQEEDLKISIILPTTFDYTEELIKATKEDPHLQLLLKTIMKGFPEKADQLPTELHHYFNFKEELTYFKGLIFKGHKIVVPKTQIPQMLKYIHQGHLGIQSCLKRAHQLLYWRGQYEDIVKLKEWRFTHSTSSPHHPQGNGLAERAVQTAKNLLRKCSIDKSDIQLALLNWRNTPRTNNLGSPNQRLYSRITRSLIPTSENNLKPKIVQGVTSELKYLRNKQANHSNKQRKEPTNYELDDRIRHKVGHRQWEGARVIEKPNDHPRSIIIKTDKGQIFRRNIGHIHNTLSDLSIGSKEAVPETVYPDDLPHAQSDKQPELPAAATTSQEQTTTSPRINCKSSASEAPVITSSDQPTTRCSRFGRTIKPVDRLDL

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00665   rve
Interpro
IPR041577   RT_RNaseH_2        + More
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
Gene 3D
PDB
4OL8     E-value=8.36274e-24,     Score=278

Ontologies

Topology

Length:
1083
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00326
Exp number, first 60 AAs:
0.00165
Total prob of N-in:
0.00017
outside
1  -  1083
 
 

Population Genetic Test Statistics

Pi
286.982136
Theta
169.676646
Tajima's D
2.798429
CLR
0.881894
CSRT
0.966851657417129
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号