SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09963
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.371 Mitochondrial   Reliability : 1.474
 

Sequence

CDS
ATGGCGGCCGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGGGCCTGACGTGGTGGTGCGCCGCCTCTACACGGGGGTGGTGCGGTCGATGGCACTGTACGGGGCTCCCGTGTGGTGCCACGACCTGACCCGCGACAACGTTGCGGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGATACCGCACCGTCTCGTTCGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTGGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCTGCTCCAGGGGGGAGCCGCGTCCTGGCGCGGCGGAAGTTCGAGCGCGGAAGCTTCAATCTCAGCGTTCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACTCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCCCCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCGGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGGGCCGGGGGCCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MAAAGSLSRLLPNVGGPDVVVRRLYTGVVRSMALYGAPVWCHDLTRDNVAALRRPQRAIAVRAVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLCSRGEPRPGAAEVRARKLQSQRSVLEAWSRRLADPAYGRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCPAFAEQRRVLVAKIGPDLSLPTVVATMLGSDESWQAMLDFCESTISRKEAAERERESSSSLSAPCRRRRAGGRRRAFVQLQPL

Summary

EMBL
AB126050    BAD86650.1    AB090825    BAC57926.1    KZ149950    PZC76665.1    + More
KZ150386    PZC71062.1    KZ150308    PZC71477.1    AB078935    BAC06462.1    AB078930    BAC06454.1    AB078931    BAC06456.1    AB078929    BAC06452.1    LBMM01012027    KMQ86470.1    RSAL01000481    RVE41577.1    KZ149896    PZC78733.1    LBMM01008861    KMQ88580.1    D85594    BAA19776.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    ODYU01009945    SOQ54696.1    LBMM01014132    KMQ85305.1    LBMM01006954    KMQ90166.1    LBMM01006909    KMQ90209.1    LBMM01009494    KMQ88097.1    KQ414641    KOC66782.1    LBMM01008682    KMQ88705.1    LBMM01003679    KMQ93242.1    KQ460685    KPJ12887.1    LBMM01024024    KMQ82631.1    GL450953    EFN80213.1    LBMM01006671    KMQ90407.1    LBMM01006725    KMQ90373.1    LBMM01006110    KMQ90925.1    LBMM01006657    KMQ90417.1    LBMM01005634    KMQ91349.1    LBMM01019838    KMQ83439.1    RSAL01003504    RVE40273.1    LBMM01019839    KMQ83438.1    LBMM01005733    KMQ91252.1    LBMM01004272    KMQ92618.1    QOIP01000031    RLU14697.1    QOIP01000010    RLU18098.1    LBMM01007036    KMQ90099.1    LBMM01015018    KMQ84954.1    LBMM01008349    KMQ88951.1    LBMM01002052    KMQ95336.1    LBMM01014909    KMQ85000.1    ABLF02023401    ABLF02029423    ABLF02060278    LBMM01002480    KMQ94776.1    LBMM01007425    KMQ89740.1    LBMM01004505    KMQ92346.1    GGMR01012534    MBY25153.1    CH963857    KRF98317.1    GGMR01011682    MBY24301.1    GGMR01005740    MBY18359.1    GGMR01015159    MBY27778.1    LBMM01008448    KMQ88867.1    LBMM01003245    KMQ93755.1    GALX01004785    JAB63681.1    GFXV01003903    MBW15708.1    ABLF02041886    ABLF02011238    QOIP01000007    RLU20280.1    ABLF02017307    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    LBMM01006063    KMQ90967.1    LBMM01012595    KMQ86127.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    ABLF02016435    ABLF02016436    ABLF02064751    GGMR01015518    MBY28137.1    GGMS01012210    MBY81413.1    GGMR01019609    MBY32228.1    AB090814    BAC57904.1    GGMR01015354    MBY27973.1    LBMM01009738    KMQ87908.1    GFXV01002090    MBW13895.1    LBMM01004697    KMQ92167.1    GGFJ01001369    MBW50510.1    GGFJ01001727    MBW50868.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07776   zf-AD
PF00096   zf-C2H2
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF17919   RT_RNaseH_2
PF00098   zf-CCHC
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
IPR029526   PGBD       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D

Ontologies

Topology

Length:
292
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01994
Exp number, first 60 AAs:
0.01163
Total prob of N-in:
0.01263
outside
1  -  292
 
 

Population Genetic Test Statistics

Pi
160.53175
Theta
58.832559
Tajima's D
3.84883
CLR
0
CSRT
0.998350082495875
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号