SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09951  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA013237
Annotation
cytochrome_P450_6ae2_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.71 PlasmaMembrane   Reliability : 1.401
 

Sequence

CDS
ATGTCAGTGAGCGCATTAGTATTTGCCGCCTTCGTTTTATTAGTGACGTATATTTACTATTGGTCGACCCGGAAATTCGATTATTGGAAGCGAAAAAATGTGCCATACGCTAAACCTGTGCCGTTCTTTGGGAATTACATGCGATATATCACTCTGCAGAGTTACATAGGAGATGTGACGCAGAAGCTGTGCCAGCAGTTCCCTGACAGACCGTACTTCGGATCGTTTTACGGCACGGAACCAGCCCTAGTCTTGCAGAATCCGGAGATCATCAAGCAAGTTTTTACTAAAGACTTCTATTACTTCAACAGCCGCGATAATAGTGATTACAATCATAAGGAAGTAGTCACACAGAACTTGTTCTTCGCAAATGGAGATAAATGGAAGGTAGTGCGTCAGAACCTAACACCGCTGTTCTCGTCGTTAAAGATGAAGAATATGTTTTACTTGGTGGAAAAATGCAACCATTCCCTTGAAGACATGCTGGACAAGGAAATCAAAGACTTGCAGATTATCGAGATCCGGTCTGCTATGATAAGGTACACGCTAGACTCTATCTGCTCTAGCGCCTTCGGTATTGAAAGTAATACCTTGAGAGAGGGCGGAGAAAATAGTCCTTTTGCAAACATGGGAAGCATCGTATTTAGTTCTTCAATAACTCGAGGACTGAAATGGATCAGTCGTTCGATGTGGCCGGGCATATTCTACAAGCTTGGTCTCCAGTGCTTTCCAGCGGAGATTGACGGTTTCTTTGAGAGAGTCCTGATTGAGGTGTTCGAGAACCGTGGCTACAAGCCGACGAACCGAAACGATTTCGTGGACTTAATTTTGAGTCTGAAACAAAACGATTACCTGACCGGAGATGGCTTGGTTCCCAAAAACGTGGACGCAAAGAAAGTGACGGTCAAGGTTGACGACGCCTTATTGATAGCGCAGTGCGTAGTCTTCTTTGGCGCAGGCTTCGAAACGTCAGCTAGCACTCTCTCGGCAGCCCTATACGAACTGGCCAAGAACCCAGAAGCCCAAAGGCGCGCTCAAGAGGAAGTTGACGAACTTTTGCTAAAACACAACAACAAGTTAAATTATGATTGTTTAGCGGAATTGCCGTACTTGGAGGCATGTATGAACGAAGCGATGCGTCTGTACCCAGTACTTCCTAATATCACCCGCGAAGCCGTGACCGACTATACGTTTCCTGATGGTCTGAGGATAGATAAGGGTATGCGTGTGCATGTCCCGGTGTATGCTATCCACCGTAACCCCGACAACTTTCCTGACCCGGAAGAGTTCCGTCCTGAGAGACATTTAGGAGACGCCAAAAACGACATTAAGCAGTTCACGTACTTCCCGTTCGGAGAAGGGCCCAGGATCTGTATTGGTATGCGCTTCGGGAAAATGCAGACCATCGCTGGGATGGTTACCTGTTTGAAAAAGTACAACTTCGAACTGGCGGATGGTATGTCGAAAACGGTGCCCTTCAGATCCACAACAGTGCTAACACAGCCAAGTACCGGATTATTCCTGAAGGCCACACCACGAGACGGCTGGAAGCAACGTCCGAACAACAACATTCGGCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGGGTATATCCTACTAAAGGAAAGTATATCCAAAGTGGTGCATAATTTGTGCAAATTATTTCCAAATGACCCCTACATTGGTGCGTTCTTTGGCACAGAGCCGACTTTAATAGTTAAAGACCCGGAATTCATTAAACTGGTATTAACTAAAGATTTCTACCATTTCAACGGCAGAGAAGGCTCCAAATACACCCACAATGAAGTTGTAACACAGAACATATTTTTCACGTACGGTGATCGGTGGAAGGTCATCCGGCAAAACCTGACGCCGCTTTTCTCTTCTTTAAAAATGAGAAACATGTTTCATATTATCGAGAAATGTTCTGGTATTTTCGAGAATTTGCTGGATGAAGAATCTTTAGCACCCGAAGTTGAAATGAAGTCTTTAATGTCGCGGTTCACAATGGACTGCATAGGCGGTTGTGCGTTCGGAGTAGACACTAAAGCGATGCAGGAACCCAAGGATAACATCTTCACAACTATGGGATACCTTTTCTTCGAGAGCACCACCTACCGAGGGATCAAGAACGTTCTCAGAGCCATTTGGCCAGGGATATTCTATGGACTAGGTCTCAAAGTATTTCCAACGGATTTAAATGAGTTTTTTAGTAAACTTCTAGTAGGGATTTTCGAAGCACGGGACTACAAGCCTTCCTCACGGAACGATTTCGTTGACCTGTTGTTAAATTTGAAGAAGAACAGACATATCGTCGGCGACCGTTTGCAAAAGACTACAACAGGAGACGAAGGAGCAGACAGTAAATTTGAACTGGAAGTGGATGATGGGCTTTTAGTGGGGCAATGCCTAGCCTTCTTTAGCGCAGGTTTTGAAACTACATCCACTATTTCAAACTTTACTTTGTACGAGCTGGCAAAGAATCCAGATGTTCAGAAAAGAGCACAGAAAGAAGTAGACGAATATATTAAAAAGCACAACAATAAACTAGATTATGATTGCGTGAAGGAGCTCCCGTTTGTGGAGGCGTGTATAGATGAAGCGCTACGCTTGTATCCTGTTCTTGGAGTATTGACAAGAGAAGTAATGGAACAATACACATTCCCGACCGGCCTGACTCTCGATAAAGGAGATCGCGTCCATATTCCCGTGTATCATCTGCAACGCGACCCGGAATACTTTCCGGAGCCAGAGCTCTTCAAGCCGGAGAGGTTTTATGGGGAAGAAAAGAAGAATATCAGACCCTTTACGTATTTGCCATTTGGGGACGGACCACGCATTTGTATTGGTATGAGGTTCGCGAAGATGCAGATCCTGGCCGGTCTGGTGACAATACTGAAAAAGTACACAGTGCAACTGGCCGACGGTATGCCGGAGACGATCGATATCGAACCCAAAGCCATTGTTACGCAGCCAGCCATTAGCATGCGACTAAAATTCGTTCCGAGAAATGATTTGCAGAAAAGAATTTTCGCATAG
Protein
MSVSALVFAAFVLLVTYIYYWSTRKFDYWKRKNVPYAKPVPFFGNYMRYITLQSYIGDVTQKLCQQFPDRPYFGSFYGTEPALVLQNPEIIKQVFTKDFYYFNSRDNSDYNHKEVVTQNLFFANGDKWKVVRQNLTPLFSSLKMKNMFYLVEKCNHSLEDMLDKEIKDLQIIEIRSAMIRYTLDSICSSAFGIESNTLREGGENSPFANMGSIVFSSSITRGLKWISRSMWPGIFYKLGLQCFPAEIDGFFERVLIEVFENRGYKPTNRNDFVDLILSLKQNDYLTGDGLVPKNVDAKKVTVKVDDALLIAQCVVFFGAGFETSASTLSAALYELAKNPEAQRRAQEEVDELLLKHNNKLNYDCLAELPYLEACMNEAMRLYPVLPNITREAVTDYTFPDGLRIDKGMRVHVPVYAIHRNPDNFPDPEEFRPERHLGDAKNDIKQFTYFPFGEGPRICIGMRFGKMQTIAGMVTCLKKYNFELADGMSKTVPFRSTTVLTQPSTGLFLKATPRDGWKQRPNNNIRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGYILLKESISKVVHNLCKLFPNDPYIGAFFGTEPTLIVKDPEFIKLVLTKDFYHFNGREGSKYTHNEVVTQNIFFTYGDRWKVIRQNLTPLFSSLKMRNMFHIIEKCSGIFENLLDEESLAPEVEMKSLMSRFTMDCIGGCAFGVDTKAMQEPKDNIFTTMGYLFFESTTYRGIKNVLRAIWPGIFYGLGLKVFPTDLNEFFSKLLVGIFEARDYKPSSRNDFVDLLLNLKKNRHIVGDRLQKTTTGDEGADSKFELEVDDGLLVGQCLAFFSAGFETTSTISNFTLYELAKNPDVQKRAQKEVDEYIKKHNNKLDYDCVKELPFVEACIDEALRLYPVLGVLTREVMEQYTFPTGLTLDKGDRVHIPVYHLQRDPEYFPEPELFKPERFYGEEKKNIRPFTYLPFGDGPRICIGMRFAKMQILAGLVTILKKYTVQLADGMPETIDIEPKAIVTQPAISMRLKFVPRNDLQKRIFA

Summary

Pfam
PF00067   p450
Interpro
IPR036396   Cyt_P450_sf        + More
IPR002401   Cyt_P450_E_grp-I       
IPR017972   Cyt_P450_CS       
IPR001128   Cyt_P450       
SUPFAM
SSF48264   SSF48264       
Gene 3D

Ontologies

Topology

Length:
1051
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
23.8042999999999
Exp number, first 60 AAs:
20.15986
Total prob of N-in:
0.78134
POSSIBLE N-term signal
sequence
inside
1  -  1
TMhelix
2  -  21
outside
22  -  1051
 
 

Population Genetic Test Statistics

Pi
197.45438
Theta
147.875942
Tajima's D
1.266131
CLR
0.055925
CSRT
0.738313084345783
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26822097 NMFYIVEK 100.00 9e-04
28467696 NPDGVAFR 100.00 9e-04
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号