SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09949
Annotation
PREDICTED:_uncharacterized_protein_LOC101747137_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.884
 

Sequence

CDS
ATGCACACGTTCACCGATGCTAGCGAGAAGGCCTACGCGTGTGCAGTCTATTGGCGTCAGAAGACAGACGAGAGCACCTACCGCGTCACGCTTCTAGCAGGGAAAGCCAGGGTGACCCCACTGAGACCAGTCTCTATCCCAAGGCTGGAGCTGCAAGCTGCGCTGCTGGGGACAAGGATGGCGCAGGCGATAGCGGACGAATTGGACATCGCAGTCGGTGTAAGGACGTACTGGACTGACTCCAGTACAGTCCTGACATGGATAAAGACCGACCCACGCACGTTCAAACCTTTCGTCGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAGAACCCAGCAGACGACGCAACTAGAGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCGAGTTCCTGACGTGGGATGAATCGCGCTGGCCCAAGCCACGAACATTCAAGCAAGAACCGTCTGGAGAGGAGAAAGAGGCCTTCCTGGTCGCCACGGCGAGGACCGCTGACGCTCGACCCACGCCCGATCCGCACAGATTCTCGAGCTGGGTCAAGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATTGAGCTGTGTCGACCCCGGAAGGAGAGCGCCTGCGTGTCCAGACAATTGAAGCAGCAAGATCCCACGTGGAGGACGACACGAACGAAGCAACCCCGATCAACATGGAAGATAAGGGCTCCAGAAGCACCTACAGAAGCGTGGCTGCCGCTTGATCCGCCCCACTTGAAGAAGGCGGAGAAGATCCTACTGAGAAGCAGCCAAGGAGAGAGCTTCGGTGAAAAAGATCCCGAACGTCACCCCAAGTTGCGACGGCTCGACGTCGTGATGGAAGATGGCCTGTTGCGCCTGCGCGGACGTATCGACGCAGCGCAATACATAGATGCAGGCTGCAAACGACCGATCGTGCTGGACGGGAAGCACGTGATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGGTAACCACGCAACGGTGATGAACGAGAGCGGCTACGACGTCATTTACAGCGACAATGGGACTAACTTCGTCGGCGCCAACAAGGACCTCAAGCAGGCAATCGAGAATGCAAGGGAAGCAGACGTCGTGTCACGGGCCGCTCAGATGAACATAAAATGGAAGTTCATCCCGCCAGGAGCGCCGAACATGGGAGGCGCGTGGGAACGTTTGGTGCGGTCCGTGAAGACCGCGCTGGCGGTCACACTGAAGGAAAGACACCCGAGGGAAGAAGTTCTGCACACTCTTCTGTTGGAGGCGGAGCACGTCGTCAACTCGCGACCGCTCGTCGCCAGGGAAGAGAGTTGGGAGTCAGAAGCACTCACGCCGAACCACTTTCTCATAGGGAGGTCCTGCGGAGCTCCGAGCATCGGCGACTACAGAGACGAAGACCTGACCGGCAAAAGGACATGGAGAGTGGCGCAGCGTATGGCAGACCACTTCTGGAGTAGGTGGGTCAAGGAATACCTGCCTACGCTGCTACCCAGGAAGATCGATGGGAGAGCAGCCGGCGAGGACTTGCAGTGTGGTGATACCGTCCTCATAGTGGACTCCACGCTGCCACGCAACACATGGCCGCGCGGACAAGTTGTCCACACCTACCCAGGCCCCGACAACCGTGTACGAACCGTCGACGTCAGAACGAGCGGCGGTCTGCTTAAGAGACCTGCCTCCAAGATGGTCCTGCTGGTGCCTGCATCGAGCGACGAGCCCCGCCCATAG
Protein
MHTFTDASEKAYACAVYWRQKTDESTYRVTLLAGKARVTPLRPVSIPRLELQAALLGTRMAQAIADELDIAVGVRTYWTDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPEFLTWDESRWPKPRTFKQEPSGEEKEAFLVATARTADARPTPDPHRFSSWVKLLRATARVLQFIELCRPRKESACVSRQLKQQDPTWRTTRTKQPRSTWKIRAPEAPTEAWLPLDPPHLKKAEKILLRSSQGESFGEKDPERHPKLRRLDVVMEDGLLRLRGRIDAAQYIDAGCKRPIVLDGKHVIARLLIKHYHEAFQHGNHATVMNESGYDVIYSDNGTNFVGANKDLKQAIENAREADVVSRAAQMNIKWKFIPPGAPNMGGAWERLVRSVKTALAVTLKERHPREEVLHTLLLEAEHVVNSRPLVAREESWESEALTPNHFLIGRSCGAPSIGDYRDEDLTGKRTWRVAQRMADHFWSRWVKEYLPTLLPRKIDGRAAGEDLQCGDTVLIVDSTLPRNTWPRGQVVHTYPGPDNRVRTVDVRTSGGLLKRPASKMVLLVPASSDEPRP

Summary

Pfam
PF05380   Peptidase_A17        + More
PF18701   DUF5641
PF17921   Integrase_H2C2
PF03564   DUF1759
PF05585   DUF1758
PF00665   rve
Interpro
IPR040676   DUF5641        + More
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR000048   IQ_motif_EF-hand-BS       
IPR005312   DUF1759       
IPR001995   Peptidase_A2_cat       
IPR008737   Peptidase_asp_put       
SUPFAM
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
598
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00121
Exp number, first 60 AAs:
0.00061
Total prob of N-in:
0.00117
outside
1  -  598
 
 

Population Genetic Test Statistics

Pi
148.457914
Theta
178.809656
Tajima's D
-0.611358
CLR
122.630432
CSRT
0.217439128043598
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号