SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09948
Annotation
PREDICTED:_uncharacterized_protein_LOC106141830_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.825
 

Sequence

CDS
ATGCCGATCACCAGGAGCAACAAGGGATCATCGAGGGAACAGCCACTCGAACCTGCGGTTCAAGAATCCAGTCCGGAGGCAACAGAAGCGACGTCGTACGAAACATACGAGAGCTCCGCGACCGGTACGACCCAGAACACAAAACTTGAAGAGGCAACGACGCGGACACGTGGTAAAAATAGACCCGCGTCGAAGAAATCGCTACGACGTAAGGAACTGGCAGCGAGAGCGGAGCTGGCGGAAAAAGAATTGATAGAAGCACAAGCAGCCACCATAGCCGCCAGACTCCGCCTGCAATTGATTCAGGCCGAAAGCGAAGACGACGATGATTCCAATATAGAAGAGCCAAAGGACCGGGAGGACCAGGTCAGGGCCTGGGTCCAGACGTCGGCGGGCAGTATGGACAAGGAGCACGCAGGCGAGCACATTGAGAACCACCCCGTCAGCAAGGCCAACATGGAAGATTGCAGCAACAGGGACCTGGCTAAGGCGATAGTGGAAGCGGTGAGGAGCGCAACGACCAAGGAGCTGCCACCACAACCCGACTACATGCACCAGTTGCCGACGTTCGAAGGCGACTGCAGGGAGTGGGTGGCCTTCAAGGCTGTCTACGAGGATACCGCTCCACTCTTCTCAAGCGCTCAAAACATGGCGCGGCTGAGAAGAGCGCTGAAGGGACAAGCCAGGGAAGGAGTCCGCAGCCAGCTGTACTCCGAGAGCACACCGGAGGAAGTAATGGAATCACTGCGGCGGTGCTATGGAAGGGCGGACGCTTTAGTCTTAGCGGAGTTAGACCGCATACGAAGACTTCCGACGATAAGCGACTCCGCCTACGACATTTGCTCACTGGCGAGCAATGTTAACAATACCGTCGCAGCGATCAGGGGGCTGCGGAAACCCCAATATTTGATGTCGCCCGAGCTGTTGAAAAGCATCGTCGACAAAATGCCGACCATCTTGAGGTTCCGGTGGTACGACCACATCATCGAAAAGACTGAAGGAGACCCGGACCTCAACACGATGTGCGGCTTCCTGAACAAGATGGCGGACCGGTGCGGGCCACACGCCGTGGCTGAAGTAGCAACGAAAAGACAACCATCGAGGCGACAGGCGACGCACGCCACAACCGACTGCACCGAGCGCGCAACTTCGGACAGAGTAATAATAGACAAGCCGGCGTGCCCGCAGTGTAAGGAAGGACACCCGCTGTATGATTGTCCGAGGTACGAGAGAGCCACGGTGCAGGAACGATGGAGAATGGCAAAGGAGTCGCGCCTATGTTACAAGTGCCTCGACGGTAAGCACCGGAAGCAATCGTGTCAACGACCGCCATGCCACACGTGCAAGCGCTGGCATCACCACTCGCTACACAACGAGAAGTCGGAGACAGAGCCAGCAGAGAACAGGGAAATCGCGAACAACGTGCGACTTCCCATCAACTGCACACGGATCAGCAGGGCGTACTTGAAGATGGTGCCCGTTGAAGTGTACGGGCCATCGGGATCGACGACGGTGCTGGCCCTGCTGGACGAAGGCTCCACTGTAACTCTCCTGGACTCGAGCGTGGCGAAGCAGATCGGCCTGAAGGGACCCAAGGAGACGCTCCGCCTCGAGACCGTGGGCGGGAAGACCCTAACGAAGAAGGACTCGATGAAGCTTAACATCAGAGTTCGAGGGCTTCACCAGCGGCAGAAGAGAATGATCTTCGGAGCGCGCACAATGGATGACATGAGCCTTGCACCCCAGCGATTGAAAAGAGAGACCATCGAAGGCTACGCGCACCTGAGGAGCCTAGCGGACCAGTTATATTACGAAGAACAATCCCCCAAACTATTGATTGGGCAGGACAACTGGGGACTCATCGCCTCCAAGACGACGCGCAGGGGCAAGAGGAACCAGCCGGTAGCCTCATTCACCCAATTGGGATGGGTGCTACATGGTCTCGACGGCAATAACGCAAAAGAGGTCAACTTCCTCACCTGCGCCCATGTATCGATGCGCGAAGAGGCCTTGGACAGACTGGTGAAGGAGCACATCGCGATAGAGTCGCACCCAAGCGTCCGAGCACGGATATGGAGGCGAAGGCGTTTGACATCTTGGAGAAGGAGGACGACAGAGGTCGGAGACGCGAAGACGACCGCTTCGAAACTCGGACCTACAATCCCTGTTCGGAGTGTTGTTGCGGCTCCGGGAAAGGCTCGTCGTGGTTGTCGCGGACATCAAGGAGAGGTTCCTGCAGATAAGGATCAGGGACGTGGACCGCGACAGCCCAAGATTCCTCTATAG
Protein
MPITRSNKGSSREQPLEPAVQESSPEATEATSYETYESSATGTTQNTKLEEATTRTRGKNRPASKKSLRRKELAARAELAEKELIEAQAATIAARLRLQLIQAESEDDDDSNIEEPKDREDQVRAWVQTSAGSMDKEHAGEHIENHPVSKANMEDCSNRDLAKAIVEAVRSATTKELPPQPDYMHQLPTFEGDCREWVAFKAVYEDTAPLFSSAQNMARLRRALKGQAREGVRSQLYSESTPEEVMESLRRCYGRADALVLAELDRIRRLPTISDSAYDICSLASNVNNTVAAIRGLRKPQYLMSPELLKSIVDKMPTILRFRWYDHIIEKTEGDPDLNTMCGFLNKMADRCGPHAVAEVATKRQPSRRQATHATTDCTERATSDRVIIDKPACPQCKEGHPLYDCPRYERATVQERWRMAKESRLCYKCLDGKHRKQSCQRPPCHTCKRWHHHSLHNEKSETEPAENREIANNVRLPINCTRISRAYLKMVPVEVYGPSGSTTVLALLDEGSTVTLLDSSVAKQIGLKGPKETLRLETVGGKTLTKKDSMKLNIRVRGLHQRQKRMIFGARTMDDMSLAPQRLKRETIEGYAHLRSLADQLYYEEQSPKLLIGQDNWGLIASKTTRRGKRNQPVASFTQLGWVLHGLDGNNAKEVNFLTCAHVSMREEALDRLVKEHIAIESHPSVRARIWRRRRLTSWRRRTTEVGDAKTTASKLGPTIPVRSVVAAPGKARRGCRGHQGEVPADKDQGRGPRQPKIPL

Summary

Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF00628   PHD
PF17921   Integrase_H2C2
PF05585   DUF1758
PF00078   RVT_1
Interpro
IPR040676   DUF5641        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
IPR021109   Peptidase_aspartic_dom_sf       
IPR019786   Zinc_finger_PHD-type_CS       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR000477   RT_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF57903   SSF57903       
Gene 3D

Ontologies

Topology

Length:
761
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00038
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00017
outside
1  -  761
 
 

Population Genetic Test Statistics

Pi
78.517331
Theta
128.732539
Tajima's D
-1.212728
CLR
480.55349
CSRT
0.103144842757862
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号