SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09947
Pre Gene Modal
BGIBMGA013239
Annotation
cytochrome_P450_CYP6AE7_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.167
 

Sequence

CDS
ATGATATTAACTATAATATTCATTCTGAGTTTATGTGTTTATATTCTCTATAGGATATCTACAAGGAAATTTGATTATTGGCAAAAGAAGAATGTGAATTACGTACAGCCGACTCCTTTCCTTGGAAACTACTCTGGGTACATACTTCTAAAGGAAAACTTATTGGACGTGGTGTATAATTTGAGTAAATTGTTTCCAAATGATCCCTACGTTGGTGCATTCTTCGGCACAAAGCCCACTTTAATCGTTAAGGACCCTGAGTTCATCAAACTCGTGTTGACAAAGGATTTTTTTTACTTCACCGGCAAAGAGTGCTTCGAGTACACCCACAAAGAAGTCATCACGCAGGGCATCATTTTCACGTACGGCGACCGCTGGAAGGTCATCCGACAAAACGTGACGCCGCTTTTCTCTTCTTCAAAAATGAGAAGCATGTTTCGCATTATCGAACATTGTTCTGGTGTTTTCGAGAATTTGCTGGATGAAGAATCTTTAGCACCCGAAGTTGAAATGAAATCTTTAATGTCGCGGTTCACAATGGACTGCATAGGCGGTTGTGTGTTCGGAGTAGACATTAATGCGATGCAGGAACCCAAGGATAACATCTTCACAACTATGGGATGCCTTTTCTTGGAGACCACCACCTCCCGAGGTATAAAAAACGTTGTCAAAGCTATCTGGCCGGAAATATTCTATGGACTAGGTTTCAAAGTATTTCCAACGGATATACATAAGTTTTTCAGTAAACTTCTAGTAAGAATTTTCGAAGCACGGGACTACAAGCCTTCCGAACGTACCGATTTCGTCGACCTGTTGTTAAATTTGAAGAAGAACAGACATATCGTCGGCGACCGCTTGCAAAAGATTAAAACAGGAGACGAAGGAGCAGACAGTAAATTTGAACTGGAAGTGGATGATGGGCTTTTAGTGGGGCAATGCCTAGCCTTCTTTAGCACAGGTTTTGAAACTTCATCCACTATTTCAAACTTTACTTTGTACGAGCTGGCAAAGAATCCAGATGTTCAGAAAAGAGCACAGAAAGAAGTAGACGAATACATTAAGAAGCACAACAATAAACTAGATTATGATTGCGTGAAGGAGCTCCCGTTTGTGGAGGCGTGTATAGATGAAGCGCTACGTTTGTATCCTCTTTTTGGGGTAATATCAAGACAAACAGGGGAACGATACACATTCCCGACCGGCCTGACTCTCGACAAAGGAGATCGCGTCCATATTCCCGTGTATCATCTGCAACGCGACCCGGAATACTTTCCGGAGCCAGAGCTCTTCAAGCCGGAGAGGTTTTATGGGGAAGAAAAGAAGAATATCAGGCCCTTTACGTATTTGCCATTTGGGGACGGACCACGCATTTGTATTGGTGAGTAG
Protein
MILTIIFILSLCVYILYRISTRKFDYWQKKNVNYVQPTPFLGNYSGYILLKENLLDVVYNLSKLFPNDPYVGAFFGTKPTLIVKDPEFIKLVLTKDFFYFTGKECFEYTHKEVITQGIIFTYGDRWKVIRQNVTPLFSSSKMRSMFRIIEHCSGVFENLLDEESLAPEVEMKSLMSRFTMDCIGGCVFGVDINAMQEPKDNIFTTMGCLFLETTTSRGIKNVVKAIWPEIFYGLGFKVFPTDIHKFFSKLLVRIFEARDYKPSERTDFVDLLLNLKKNRHIVGDRLQKIKTGDEGADSKFELEVDDGLLVGQCLAFFSTGFETSSTISNFTLYELAKNPDVQKRAQKEVDEYIKKHNNKLDYDCVKELPFVEACIDEALRLYPLFGVISRQTGERYTFPTGLTLDKGDRVHIPVYHLQRDPEYFPEPELFKPERFYGEEKKNIRPFTYLPFGDGPRICIGE

Summary

Similarity
Belongs to the cytochrome P450 family.
EMBL
BABH01022698    BABH01022705    EF432656    ABO21682.1    BABH01022694    GU731531    + More
ADE05581.1    DQ256407    ABB69054.1    KM016736    AID54888.1    NWSH01003425    PCG66327.1    KM016740    AID54892.1    KM016738    AID54890.1    KX443432    ASO98007.1    JTDY01000942    KOB75351.1    KJ671576    AID55428.1    NWSH01002369    PCG68452.1    KU145393    ANC96676.1    ODYU01000082    SOQ34236.1    PCG68453.1    EU807990    ACF17813.2    KY212045    ARA91609.1    KM016735    AID54887.1    JN375491    AEY75585.1    JTDY01005369    KOB67074.1    FN356971    CAX94849.1    NWSH01002736    PCG67604.1    JN375489    AEY75583.1    ODYU01008863    SOQ52829.1    KX443430    ASO98005.1    KX443435    ASO98010.1    ODYU01000083    SOQ34238.1    GCVX01000058    JAI18172.1    KP001126    AJN91171.1    JX310078    AFP20589.1    KY212043    ARA91607.1    JTDY01009617    KOB63214.1    GQ241737    ADD70250.1    GU937509    ADW23116.1    KM016737    AID54889.1    AK343205    BAM73891.1    AK289291    AK343204    BAM73818.1    BAM73890.1    KR095600    AKS48888.1    DQ986461    JN176574    ABI84381.1    AET11931.1    FJ387169    ACJ10074.1    KM016744    AID54896.1    KJ645907    AIJ00764.1    KJ645906    AIJ00763.1    RSAL01000158    RVE45549.1    GCVX01000081    JAI18149.1    PCG67605.1    KM016739    AID54891.1    AK343206    BAM73892.1    RVE45548.1    PCG68451.1    EU273877    ABX64440.1    RVE45547.1    KY212044    ARA91608.1    EF535809    ABQ08711.1    KM016742    AID54894.1    AK289290    BAM73817.1    EU309477    ABY40426.1    AY295774    AAP83689.1    EF432657    ABO21683.1    EF415296    ABN71367.1    KJ671575    AID55427.1    EU273875    ABX64438.1    KM016741    AID54893.1    EF528485    ABP99019.1    EF547545    ABQ42339.1    EF528486    ABP99020.1    JTDY01000272    KOB77971.1    KQ460655    KPJ12961.1    KQ459388    KPJ01135.1    ODYU01004193    SOQ43795.1    KP001127    AJN91172.1    JX310077    AFP20588.1    FN544262    CBB07053.1    KF853191    AHH92929.1    MH236461    QBA57466.1    KJ645905    AIJ00762.1    ODYU01004192    SOQ43793.1    GCVX01000049    JAI18181.1    KX844829    ASQ44127.1    NWSH01000502    PCG75998.1    KJ645904    AIJ00761.1    KX443433    ASO98008.1    KX443431    ASO98006.1    KZ150141    PZC72944.1    KF701137    AHW57307.1    JX310082    AFP20593.1    GQ915322    ACZ97416.2    KM016743    AID54895.1    ODYU01006311    SOQ48049.1    ODYU01004424    SOQ44278.1    RVE45546.1    KX443434    ASO98009.1    JX310083    AFP20594.1    GU731530    ADE05580.1    KJ645909    AIJ00766.1    FJ843077    ACO55746.1   
Pfam
PF00067   p450        + More
PF09453   HIRA_B
Interpro
IPR036396   Cyt_P450_sf        + More
IPR002401   Cyt_P450_E_grp-I       
IPR001128   Cyt_P450       
IPR017972   Cyt_P450_CS       
IPR019015   HIRA_B_motif       
IPR002403   Cyt_P450_E_grp-IV       
SUPFAM
SSF48264   SSF48264       
Gene 3D
PDB
6MJM     E-value=9.21104e-48,     Score=481

Ontologies

Topology

Length:
461
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
12.50528
Exp number, first 60 AAs:
12.35075
Total prob of N-in:
0.59346
POSSIBLE N-term signal
sequence
outside
1  -  461
 
 

Population Genetic Test Statistics

Pi
113.157023
Theta
141.753469
Tajima's D
-0.93297
CLR
0.672945
CSRT
0.153692315384231
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号