SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09946
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.866
 

Sequence

CDS
ATGAACACGCGCCCGGCCCGCGTCCCGAAACGATGTAACAAACAGCATTTATCTGTGTTCAGGACCGGGTACCCGCAGGTAGTCGTGACACCGGAGTCGGACTCCGCTCGCCGCGTAACCCCGCCGCCGCGTCCCAAGCCCGCGCCCGCTCCTAAAGTAGCTGCCCCGCCCCCGCTGATACTTCAAGAGAAGACAGCGTGGAATCGCGTATCCCAGGCCCTTCAGGCAAATAAAATTAACTACACCCATGCGCGTAACGTCGCGCATGGGATTCAGATTAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCAGCATACCTCCGAAAGGAGAACATAGGTTTCCACACCTATGCTCTTCAGGAGGACCGCGAGCTCCGCGTAGTAATACGCGGAGTACCGAAAGAACTAGACATAGACTACGTTAAGGAGGACCTGATCGCTCAGGCACTCCCTATAGTTAGTGTGCATCGGATGCACAGTGGGCGGGGCAAGCAGCCCTACAACATGATACTCGTCGCGTTGGAGCCAACCCCGGAGGCAAAAAAGCAAATCTCATGCCTCTCGACAGTTTGCGGCCTATCCGGGGTCTCCATCGAAGCCCCCCATAGACGTGGCACTCCCGGGCAGTGCTACAGATGCCAGCTTTACGGCCACTCGGCTCGTAATTGCCACGCGCGCCCCCGCTGCGTAAAGTGCCTCGGCGACCACGCCACATCAGATTGCTCGCGTGTTAGGGAAACCGCGACCGAACCTCCAAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCTAGGGCTCCGCGAAAACGTCCAACTCACCCGGCTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCTTCAGTGCCGAAACCCGCCTTCGTGCCGGCTGCAGTTCCCACGGTCTCGGCGTGGAAAAAACCGCTGCCGTATACTAAGGCGGGAACGGAAACCGCACCCCCGCCCCCGCTCGTGACACGCCCCGCGCCCCAGCCTCTGCTCGCACCTCGCCTCGCGCCCGCGTTCCGTCCCCCGCAACCCTTTGCCGTCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTGAACTTCGACCGTCTGCGATCGTTCGCTGACGCTATCCGTAGGTCGGTAACCCCCGAACAGCGGCTCGCGGCCGCCTTCGACCACATGGACGTTTACGAGTCCGTGTCGCCATTCTACAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTCGAATTCCTCCGCGACAATCTTATAGATATCTTGTTAGTGCAGGAGACCTGTCTGAAGCCCTCGCGTCGCGACCCGAAAGTCGCGAACTACGTCATGGTTAGGAATGACAGACTCACCGCCTCGAAAGGCGGGACTGCCATTTACTATAGACGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACAAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAATAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACGCCGCTCCGCCAATCCTCCCTTACAGCCCGGATTCGAATCCATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCTAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCAGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCTTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGATGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCAGGCTCCGACGGCATCCACAACCGCGCGCTAAAATTTTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGAGAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAACGTCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCAAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATCTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACCGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCCTGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATTCCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCGAAGCAAACTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCTTGGTTCCTTAGGAATGTGGATCTCCACGACGACCTGGAGCTCGACTCTTTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGCTGGTCCTTCGAGCCGGATACAGCGATTATTCAACGATGCCGATCACCAGGAGCAACAAGGGATCATCGAGGGAACAGCCACTCGAACCTGCGGTTCAAGAATCCAGTCCGGAGGCAACAGAAGCGACGTCGTACGAAACATACGAGAGCTCCGCGACCGGTACGACCCAGAACACAAAACTTGAAGAGGCAACGACGCGGACACGTGGTAAAAATAGACCCGCGTCGAAGAAATCGCTACGACGTAAGGAACTGGCAGCGAGAGCGGAGCTGGCGGAAAAAGAATTGATAGAAGCACAAGCAGCCACCATAGCCGCCAGACTCCGCCTGCAATTGATTCAGGCCGAAAGCGAAGACGACGATGATTCCAATATAGAAGAGCCAAAGGACCGGGAGGACCAGGTCAGGGCCTGGGTCCAGACGTCGGCGGGCAGTATGGACAAGGAGCACGCAGGCGAGCACATTGAGAACCACCCCGTCAGTAAGGCCAACATGGAAGATTGCAGCAACAGGGACCTGGCTAAGGCGATAGTGGAAGCGGTGAGGAGCGCAACGACCAAGGAGCTGCCACCACAACCCGACTACATGCACCAGTTGCCGACGTTCGAAGGCGACTGCAGGGAGTGGGTGGCCTTCAAGGCTGTCTACGAGGATACCGCTCCACTCTTCTCAAGCGCTCAAAACATGGCGCGGCTGAGAAGAGCGCTGAAGGGACAAGCCAGGGAAGGAGTCCGCAGCCAGCTGTACTCCGAGAGCACACCGGAGGAAGTAATGGAATCACTGCGGCGGTGCTATGGAAGGGCGGACGCTTTAGTCTTAGCGGAGTTAGACCGCATACGAAGACTTCCGACGATAAGCGACTCCGCCTACGACATTTGCTCACTGGCGAGCAATGTTAACAATACCGTCGCAGCGATCAGGGGGCTGCGGAAACCCCAATATTTGATGTCGCCCGAGCTGTTGAAAAGCATCGTCGACAAAATGCCGACCATCTTGAGGTTCCGGTGGTACGACCACATCATCGAAAAGACTGAAGGAGACCCGGACCTCAACACGATGTGCGGCTTCCTGAACAAGATGGCGGACCGGTGCGGGCCACACGCCGTGGCTGAAGTAGCAACGAAAAGACAACCATCGAGGCGACAGGCGACGCACGCCACAACCGACTGCACCGAGCGCGCAACTTCGGACAGAGTAATAATAGACAAGCCGGCGTGCCCGCAGTGTAAGGAAGGACACCCGCTGTATGATTGTCCGAGGTACGAGAGAGCCACGGTGCAGGAACGATGGAGAATGGCAAAGGAGTCGCGCCTATGTTACAAGTGCCTCGACGGTAAGCACCGGAAGCAATCGTGTCAACGACCGCCATGCCACACGTGCAAGCGCTGGCATCACCACTCGCTACACAACGAGAAGTCGGAGACAGAGCCAGCAGAGAACAGGGAAATCGCGAACAACGTGCGACTTCCCATCAACTGCACACGGATCAGCAGGGCGTACTTGAAGATGGTGCCCGTTGAAGTGTACGGGCCATCGGGATCGACGACGGTGCTGGCCCTGCTGGACGAAGGCTCCACTGTAACTCTCCTGGACTCGAGCGTGGCGAAGCAGATCGGCCTGAAGGGACCCAAGGAGACGCTCCGCCTCGAGACCGTGGGCGGGAAGACCCTAACGAAGAAGGACTCGATGAAGCTTAACATCAGAGTTCGAGGGCTTCACCAGCGGCAGAAGAGAATGATCTTCGGAGCGCGCACAATGGATGACATGAGCCTTGCACCCCAGCGATTGAAAAGAGAGACCATCGAAGGCTACGCGCACCTGAGGAGCCTAGCGGACCAGTTATATTACGAAGAACAATCCCCCAAACTATTGATTGGGCAGGACAACTGGGGACTCATCGCCTCCAAGACGACGCGCAGGGGCAAGAGGAACCAGCCGGTAGCCTCATTCACCCAATTGGGATGGGTGCTACATGGTCTCGACGGCAATAACGCAAAAGAGGTCAACTTCCTCACCTGCGCCCATGTATCGATGCGCGAAGAGGCCTTGGACAGACTGGTGAAGGAGCACATCGCGATAGAGTCGCACCCAAGCGTCCGAGCACGGATATGGAGGCGAAGGCGTTTGACATCTTGGAGAAGGAGGACGACAGAGGTCGGAGACGCGAAGACGACCGCTTCGAAACTCGGACCTACAATCCCTGTTCGGAGTGTTGTTGCGGCTCCGGGAAAGGCTCGTCGTGGTTGTCGCGGACATCAAGGAGAGGTTCCTGCAGATAAGGATCAGGGACGGGAGATGCACACGTTCACCGATGCTAGCGAGAAGGCCTACGCGTGTGCAGTCTATTGGCGTCAGAAGACAGACGAGAGCACCTACCGCGTCACGCTTCTAGCAGGGAAAGCCAGGGTGACCCCACTGAGACCAGTCTCTATCCCAAGGCTGGAGCTGCAAGCTGCGCTGCTGGGGACAAGGATGGCGCAGGCGATAGCGGACGAATTGGACATCGCAGTCGGTGTAAGGACGTACTGGACTGACTCCAGTACAGTCCTGACATGGATAAAGACCGACCCACGCACGTTCAAACCTTTCGTCGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAGAACCCAGCAGACGACGCAACTAGAGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCGAGTTCCTGACGTGGGATGAATCGCGCTGGCCCAAGCCACGAACATTCAAGCAAGAACCGTCTGGAGAGGAGAAAGAGGCCTTCCTGGTCGCCACGGCGAGGACCGCTGACGCTCGACCCACGCCCGATCCGCACAGATTCTCGAGCTGGGTCAAGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATTGAGCTGTGTCGACCCCGGAAGGAGAGCGCCTGCGTGTCCAGACAATTGAAGCAGCAAGATCCCACGTGGAGGACGACACGAACGAAGCAACCCCGATCAACATGGAAGATAAGGGCTCCAGAAGCACCTACAGAAGCGTGGCTGCCGCTTGATCCGCCCCACTTGAAGAAGGCGGAGAAGATCCTACTGAGAAGCAGCCAAGGAGAGAGCTTCGGTGAAAAAGATCCCGAACGTCACCCCAAGTTGCGACGGCTCGACGTCGTGATGGAAGATGGCCTGTTGCGCCTGCGCGGACGTATCGACGCAGCGCAATACATAGATGCAGGCTGCAAACGACCGATCGTGCTGGACGGGAAGCACGTGATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGGTAACCACGCAACGGTGATGAACGAGAGCGGCTACGACGTCATTTACAGCGACAATGGGACTAACTTCGTCGGCGCCAACAAGGACCTCAAGCAGGCAATCGAGAATGCAAGGGAAGCAGACGTCGTGTCACGGGCCGCTCAGATGAACATAAAATGGAAGTTCATCCCGCCAGGAGCGCCGAACATGGGAGGCGCGTGGGAACGTTTGGTGCGGTCCGTGAAGACCGCGCTGGCGGTCACACTGAAGGAAAGACACCCGAGGGAAGAAGTTCTGCACACTCTTCTGTTGGAGGCGGAGCACGTCGTCAACTCGCGACCGCTCGTCGCCAGGGAAGAGAGTTGGGAGTCAGAAGCACTCACGCCGAACCACTTTCTCATAGGGAGGTCCTGCGGAGCTCCGAGCATCGGCGACTACAGAGACGAAGACCTGACCGGCAAAAGGACATGGAGAGTGGCGCAGCGTATGGCAGACCACTTCTGGAGTAGGTGGGTCAAGGAATACCTGCCTACGCTGCTACCCAGGAAGATCGATGGGAGAGCAGCCGGCGAGGACTTGCAGTGTGGTGATACCGTCCTCATAGTGGACTCCACGCTGCCACGCAACACATGGCCGCGCGGACAAGTTGTCCACACCTACCCAGGCCCCGACAACCGTGTACGAACCGTCGACGTCAGAACGAGCGGCGGTCTGCTTAAGAGACCTGCCTCCAAGATGGTCCTGCTGGTGCCTGCATCGAGCGACGAGCCCCGCCCATAG
Protein
MNTRPARVPKRCNKQHLSVFRTGYPQVVVTPESDSARRVTPPPRPKPAPAPKVAAPPPLILQEKTAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGFHTYALQEDRELRVVIRGVPKELDIDYVKEDLIAQALPIVSVHRMHSGRGKQPYNMILVALEPTPEAKKQISCLSTVCGLSGVSIEAPHRRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATSDCSRVRETATEPPSCVLCLKQGHPANYRGCPRAPRKRPTHPAPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTETAPPPPLVTRPAPQPLLAPRLAPAFRPPQPFAVNDFALVRDFVTAVNFDRLRSFADAIRRSVTPEQRLAAAFDHMDVYESVSPFYNANGLARQRDQIFEFLRDNLIDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLLHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADAAPPILPYSPDSNPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIQMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLLRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIHNRALKFLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPRNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATLGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSFSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMLVLRAGYSDYSTMPITRSNKGSSREQPLEPAVQESSPEATEATSYETYESSATGTTQNTKLEEATTRTRGKNRPASKKSLRRKELAARAELAEKELIEAQAATIAARLRLQLIQAESEDDDDSNIEEPKDREDQVRAWVQTSAGSMDKEHAGEHIENHPVSKANMEDCSNRDLAKAIVEAVRSATTKELPPQPDYMHQLPTFEGDCREWVAFKAVYEDTAPLFSSAQNMARLRRALKGQAREGVRSQLYSESTPEEVMESLRRCYGRADALVLAELDRIRRLPTISDSAYDICSLASNVNNTVAAIRGLRKPQYLMSPELLKSIVDKMPTILRFRWYDHIIEKTEGDPDLNTMCGFLNKMADRCGPHAVAEVATKRQPSRRQATHATTDCTERATSDRVIIDKPACPQCKEGHPLYDCPRYERATVQERWRMAKESRLCYKCLDGKHRKQSCQRPPCHTCKRWHHHSLHNEKSETEPAENREIANNVRLPINCTRISRAYLKMVPVEVYGPSGSTTVLALLDEGSTVTLLDSSVAKQIGLKGPKETLRLETVGGKTLTKKDSMKLNIRVRGLHQRQKRMIFGARTMDDMSLAPQRLKRETIEGYAHLRSLADQLYYEEQSPKLLIGQDNWGLIASKTTRRGKRNQPVASFTQLGWVLHGLDGNNAKEVNFLTCAHVSMREEALDRLVKEHIAIESHPSVRARIWRRRRLTSWRRRTTEVGDAKTTASKLGPTIPVRSVVAAPGKARRGCRGHQGEVPADKDQGREMHTFTDASEKAYACAVYWRQKTDESTYRVTLLAGKARVTPLRPVSIPRLELQAALLGTRMAQAIADELDIAVGVRTYWTDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPEFLTWDESRWPKPRTFKQEPSGEEKEAFLVATARTADARPTPDPHRFSSWVKLLRATARVLQFIELCRPRKESACVSRQLKQQDPTWRTTRTKQPRSTWKIRAPEAPTEAWLPLDPPHLKKAEKILLRSSQGESFGEKDPERHPKLRRLDVVMEDGLLRLRGRIDAAQYIDAGCKRPIVLDGKHVIARLLIKHYHEAFQHGNHATVMNESGYDVIYSDNGTNFVGANKDLKQAIENAREADVVSRAAQMNIKWKFIPPGAPNMGGAWERLVRSVKTALAVTLKERHPREEVLHTLLLEAEHVVNSRPLVAREESWESEALTPNHFLIGRSCGAPSIGDYRDEDLTGKRTWRVAQRMADHFWSRWVKEYLPTLLPRKIDGRAAGEDLQCGDTVLIVDSTLPRNTWPRGQVVHTYPGPDNRVRTVDVRTSGGLLKRPASKMVLLVPASSDEPRP

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00305898,     Score=104

Ontologies

Topology

Length:
2669
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.07749
Exp number, first 60 AAs:
0.00031
Total prob of N-in:
0.00009
outside
1  -  2669
 
 

Population Genetic Test Statistics

Pi
139.736599
Theta
164.32885
Tajima's D
0.210194
CLR
0.312205
CSRT
0.429228538573071
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号