SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09944
Pre Gene Modal
BGIBMGA013241
Annotation
cytochrome_P450_CYP6AE7_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.819
 

Sequence

CDS
ATGATATTAACTATAATATTCATTCTGAGTTTATGTGTTTACATTCTCTATAGGATATCTACAAGGAAATTTGATTATTGGCAAAAAAAGAATGTGAGCTACGTAGAGCCGGCTCCTTTCCTCGGAAACTACTCTGGGTACATACTTCTAAAGGAAAACTTATTGGACGTGGTGCATAATTTGAGTAAATTGTTTCCAAATGACCCCTACGTTGGTGCATTCTTTGGCACAAAACCCACTTTAATCGTTAAAGACCCGGAATTCATTAAACTGGTACTAATTAAAGATTTCTACTATTTCCACGGGAGAGAAGGCTCCAAATACACCCACAATGAAGTCATCACGCAGGGCATATTTTTCACGTACGGCGACCGCTGGAAGGTCATTCGACAAAACCTGACGCCGCTTTTCTCTTCTTCAAAAATTAGAAACATGTTTCGTACTATCGAAAAATGTTCTGGTGTTTTCGAGAATTTGCTGGATGAAGAATCTTTAGCACCCGAAGTTGAAATGAGGTCTGTGATGTCGCGGTTCACAATGGACTGCATAGGCGGTTGTGCGTTCGGAGTAGACACTAATGCGATGCAGGAACCCAAGGATAACATCTTCAAAACTATGGGATACCTTTTCTTCGAGAGCACCACGCACCGAGGGATAAAGAACGTTTTCAAAGCTATCTGGCCGGAAATATTCTATGGACTAGGTTTCAAAGTATTTCCAACGGACTTAAATGAGTTTTTTAGTAAACTTCTAGTTGGGATTTTCGAAGCACGGGACTACAAGCCTTCCTCACAGAATGTTTTCATCAACCTGTTGTTAAATTTGAAGAAGAACAGACATATCGTCGGCGACCGTTTGCTAAAGATTAAAACAGGAAACGTAAGAGCAGAGAGTAAAATAAAACTAGAAGTGGATGATGAGCTGTTAGTTTCGCAATGCGTTGCCTTCTTTATCGCAGGCTTTGAAACTTCATCCACTATTTCAAGCTTTACTTTGTACGAGCTGGCAAAGAATCCAGATGTTCAGAAAAGAGCGCAGAAAGAAGTGGACGAATACATTAAGAAGCACAACAATAAACTAGATTATGATTGCGTGAAGGAGCTCCCGTTTGTGGAGGCGTGTATAGATGAAGCCCTACGTTTGTATCCCGTTCTTGGAGTATTGACAAGAGAAGTAATGGAACAATACACATTCCCGACCGGCCTGACTCTCGACAAAGGAGATCGCGTTCATATTCCCGTGTATCATCTGCAACGCGACCCGGAATACTTTCCGGAGCCAGAGCTCTTTAAGCCGGAGAGGTTCTATGGGGAAGAGAAAAGGAATATCAGGCCCTTTACGTATTTACCATTTGGAGCTGGGCCCCGAACTTGTATTGGTCAAAGATTTGCGAAGATGCAGATGTTGGCCGGCCTGGTGACCATACTGAAAAGGTACACGGTGCGTCTGGCCGAGGGCATGCCGGAGACGATCAACTTCGAACAGAGAGCAATTGTCACGCAGCCCAACATTGGAATACGACTGAATCTCTTGCCTAGAAACAATTAA
Protein
MILTIIFILSLCVYILYRISTRKFDYWQKKNVSYVEPAPFLGNYSGYILLKENLLDVVHNLSKLFPNDPYVGAFFGTKPTLIVKDPEFIKLVLIKDFYYFHGREGSKYTHNEVITQGIFFTYGDRWKVIRQNLTPLFSSSKIRNMFRTIEKCSGVFENLLDEESLAPEVEMRSVMSRFTMDCIGGCAFGVDTNAMQEPKDNIFKTMGYLFFESTTHRGIKNVFKAIWPEIFYGLGFKVFPTDLNEFFSKLLVGIFEARDYKPSSQNVFINLLLNLKKNRHIVGDRLLKIKTGNVRAESKIKLEVDDELLVSQCVAFFIAGFETSSTISSFTLYELAKNPDVQKRAQKEVDEYIKKHNNKLDYDCVKELPFVEACIDEALRLYPVLGVLTREVMEQYTFPTGLTLDKGDRVHIPVYHLQRDPEYFPEPELFKPERFYGEEKRNIRPFTYLPFGAGPRTCIGQRFAKMQMLAGLVTILKRYTVRLAEGMPETINFEQRAIVTQPNIGIRLNLLPRNN

Summary

Cofactor
heme
Similarity
Belongs to the cytochrome P450 family.
EMBL
BABH01022705    EF432656    ABO21682.1    BABH01022698    BABH01022694    GU731531    + More
ADE05581.1    DQ256407    ABB69054.1    KM016736    AID54888.1    NWSH01003425    PCG66327.1    KU145393    ANC96676.1    KM016740    AID54892.1    JTDY01000942    KOB75351.1    KM016738    AID54890.1    KX443435    ASO98010.1    KX443432    ASO98007.1    NWSH01002369    PCG68452.1    KJ671576    AID55428.1    KX443430    ASO98005.1    ODYU01000082    SOQ34236.1    JX310078    AFP20589.1    JTDY01005369    KOB67074.1    JN375491    AEY75585.1    ODYU01008863    SOQ52829.1    KM016735    AID54887.1    KM016744    AID54896.1    NWSH01002736    PCG67604.1    JN375489    AEY75583.1    PCG68453.1    EU807990    ACF17813.2    FN356971    CAX94849.1    PCG67605.1    KM016737    AID54889.1    GU937509    ADW23116.1    KR095600    AKS48888.1    DQ986461    JN176574    ABI84381.1    AET11931.1    KM016742    AID54894.1    GCVX01000058    JAI18172.1    KP001126    AJN91171.1    GQ241737    ADD70250.1    RSAL01000158    RVE45548.1    KM016741    AID54893.1    AK289291    AK343204    BAM73818.1    BAM73890.1    RVE45547.1    AK343205    BAM73891.1    KY212045    ARA91609.1    JTDY01009617    KOB63214.1    KJ671575    AID55427.1    FJ387169    ACJ10074.1    KJ645906    AIJ00763.1    EU309477    ABY40426.1    AK289290    BAM73817.1    PCG68451.1    EF415296    ABN71367.1    EU273875    ABX64438.1    KM016739    AID54891.1    KY212043    ARA91607.1    AY295774    AAP83689.1    RVE45549.1    EF547545    ABQ42339.1    EF528486    ABP99020.1    EF432657    ABO21683.1    JTDY01000272    KOB77971.1    EU273877    ABX64440.1    EF528485    ABP99019.1    JX310077    AFP20588.1    EF535809    ABQ08711.1    AK343206    BAM73892.1    ODYU01000083    SOQ34238.1    GCVX01000081    JAI18149.1    KJ645907    AIJ00764.1    KP001127    AJN91172.1    KY212044    ARA91608.1    JX310082    AFP20593.1    KX844829    ASQ44127.1    KX443431    ASO98006.1    KF853191    AHH92929.1    MH236461    QBA57466.1    KJ645905    AIJ00762.1    KF701137    AHW57307.1    KQ459388    KPJ01135.1    KQ460655    KPJ12961.1    GCVX01000049    JAI18181.1    FN544262    CBB07053.1    RVE45546.1    KJ645904    AIJ00761.1    KX443433    ASO98008.1    NWSH01000502    PCG75998.1    KZ150141    PZC72944.1    ODYU01004424    SOQ44278.1    GQ915322    ACZ97416.2    KM016743    AID54895.1    JX310083    AFP20594.1    KX443434    ASO98009.1    FJ843077    ACO55746.1    KJ645909    AIJ00766.1    GU731530    ADE05580.1    ODYU01004193    SOQ43795.1    KJ645908    AIJ00765.1    MH151918    QAX33066.1    ODYU01004192    SOQ43793.1   
Pfam
PF00067   p450        + More
PF09453   HIRA_B
Interpro
IPR036396   Cyt_P450_sf        + More
IPR002401   Cyt_P450_E_grp-I       
IPR001128   Cyt_P450       
IPR017972   Cyt_P450_CS       
IPR019015   HIRA_B_motif       
IPR002403   Cyt_P450_E_grp-IV       
IPR002402   Cyt_P450_E_grp-II       
SUPFAM
SSF48264   SSF48264       
Gene 3D
PDB
6MJM     E-value=5.86535e-53,     Score=526

Ontologies

Topology

Length:
515
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
12.34126
Exp number, first 60 AAs:
12.17863
Total prob of N-in:
0.60497
POSSIBLE N-term signal
sequence
outside
1  -  515
 
 

Population Genetic Test Statistics

Pi
260.270549
Theta
186.291388
Tajima's D
1.039487
CLR
0
CSRT
0.669566521673916
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号