SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09921
Annotation
S33901_reverse_transcriptase_-_silkworm_transposon_Pao
Location in the cell
Mitochondrial   Reliability : 1.932 Nuclear   Reliability : 2.219
 

Sequence

CDS
ATGAACTCCTTTACAAAAACAGAAAATATAAACAGACTCAGAAGGAACCTGAAAGGAAGGGCAAAGGAAGCCGTTGACGGATTACTTATAACAAACGCTGATCCGTCCGACGTCATAAGAAGTCTAGAAGCGCGATTCGGAAGACCGGAAACGATAGCCATAACGGAGTTAGACACGCTACGAGCTCTGCCAAGACTAACAGAAACACCAAGAGACATTTGTATATTCTCCAGTAAGGTGACCACCGCCGTAGCTACGCTTCGTGCATTAAATTGCACACATTACTTATATAATCCGGAAACTACCAAAACAATGTTAGAAAAACTCACACCAACACTACGTTACCGATACTACGACTTCACCGCGATACAACCGAAGGAGGATCCGGATCTGATTAAATTTGAAAAATTCATGAAAAGAGAAGCCGAACTGTGCAGCCCTTATGCACAGCCTGAACAGGCGGGGCACTACTCGCAGCCCGCACAACATAACAGACGCACACAAAACGTGCACATAGTCAGTGAGAAGCCATCACGAGCTAAATGTCCGGTATGTAGCAACACCGAACACACCACAACAGACTGCTACATATTCAAGAAGGCAGACTCAAACACAAGATGGGACATCGCTAAGAATAAACACCTGTGTTTCCGATGTCTCAAGTATAGAAATAAAACCCACAACTGTAGACCGAAGACTTGTGGCATCAATGATTGCAAATATACTCACAACAAGATGCTACACTTCGACAGAAAAATTGAAAAAACAGACAACAGTGACAAGGAAACAACAGAGAACATTAATTCCGCTTGGACCGGAAAACAGAAACAGTCCTATTTGAAAATAATCCCAGTCCAAGTACAAGGACCGATAGGCACGGTTGATACATACGCGCTGCTCGACGATGGATCAACGGTAACACTGATAGACGAAATTATTTGCAAGAAGACTGGAATAACAGGACCAATCGATCCGTTACACATACAGGCGATTAACAACATAAAATCAACGGAAACAAGGTCAAGAAGAGTCAACCTCACGCTCAGAGGCCTCAACAGTCGAAAAGAAATAATACAAGCGAGAACAGTTAACGACCTACAAGTAACAGCACAAAAAATACCAAAGGAACAGATAGATGAGTATTCGCACCTACGAGACATCAGTGACATCATCACGTACGAGAACGCGAAACCTGGAATCCTGATTGGCCAAGACAACTGGCACATGTTACTAACTTCAAAAGTTAGACGAGGCAACAGGAATCAGCCAATAGCGTCACTGACCCCTCTAGGCTGGGTATTGCATGGAGGTCGCACTCGTACCCTAGGCCACCACATAAACTACATAAATCATGCTAGCGAAACCCAGGAAGATGATAAAATAGAAAATCTGGTAAAACAGTATTTCGCTATGGATGCGCTATGCATCACACCAAGAAGACCAAAAACAGACCCAGAGGAACAGGCGCTTCGCATCCTCAACAGCAATACAGTCCACACAACAGATGGAAGATACGAAACTGCTCTGCTCTGGAAAACAGATAATGTCAGTCTACCAGACAACTACAATAACTCGTTAAAGCGACTGATAAATATAGAAAACAAACTCGATCGTAATCTGGAACTGAAACAGAAATACACAGAACAGATGGAAGCACTCGTCGCGAAAGGCTACGCCGAGCCCGCTCCAAAAACAAAAACAGAGAACAGAACGTGGTATCTACCTCACTTTGCCGTCGTGAACCCCCTGAAGCCGGAAAAACTCCGAGTTGTCCACGACGCCGCCGCCAGAACAGGAGGGGTAGCTTTGAATTATATGCTGCTTAAGGGACCGGACGTACTCCAATCACTACCAGGAGTGATAATGCGATTTAGACAGCATAATATAGCAGTAACAGCAGACATCAAAGAGATGTTCATACAAGTAAAATTGAGACCTGAAGACAAAGACGCGCTCCGTTATCTCTGGCGCAAAGATCAGCGAGATGACAAGCCTCCAGAAGAAAACAGAATGACCTCGTTGATCTTCGGTGCGTCAAGTTCTCCTTCCACAGCAATATATGTAAAGAACTTGACCGCCCAGAAACAAGAAGCCACGCACCCGGAGGCGGCAGTCGCAGTACAGAACAGACACTACGTAGACGACTACTTGGATAACTTCAAAACTTTAAAAGATGCAGTTCACATAACTAAAGACTTTCGTCGAAAACACGAAAGAAAGCCGACCTCGAAGACCTTCTGGACCGACAGTAAGATAGTGTTGAGATGGACAAGGACGGGATCACGCTCGTACAAACCTTACGTCACCCAACGCCTGACAGCTATAGAAGATAGTTCAACAATAAACGGGAGGCGATGGTTACCCACAAAGCACAACGTAGCCGACGACGTGACCCGAGATGTCCCAATGTCGTATCAGAATGAACATAAATGGCTCAAAGGACGAGAATTCCTACGCCAACGACGAGACTCCTGGCCCACGGAGTCGGCGACAGTAACAACAACAAAATTAATAGATAAAGTAAACATAGCAGCTGCAGCACCGGCGGGAGCCTCATGGCCGAGGCGTCCCGACAACGTGGGGCGCACCGTAGACCTCAAGGGTGGAGTTCTACGGAGACCAGTACGAAAACTACTGATCCTGCCCATCGAAGAAGACCATCCTGCACCGAGAAGAATGCGACTGACTCGCACGGCGGGAGTAATGTGCAGGACGAAATAG
Protein
MNSFTKTENINRLRRNLKGRAKEAVDGLLITNADPSDVIRSLEARFGRPETIAITELDTLRALPRLTETPRDICIFSSKVTTAVATLRALNCTHYLYNPETTKTMLEKLTPTLRYRYYDFTAIQPKEDPDLIKFEKFMKREAELCSPYAQPEQAGHYSQPAQHNRRTQNVHIVSEKPSRAKCPVCSNTEHTTTDCYIFKKADSNTRWDIAKNKHLCFRCLKYRNKTHNCRPKTCGINDCKYTHNKMLHFDRKIEKTDNSDKETTENINSAWTGKQKQSYLKIIPVQVQGPIGTVDTYALLDDGSTVTLIDEIICKKTGITGPIDPLHIQAINNIKSTETRSRRVNLTLRGLNSRKEIIQARTVNDLQVTAQKIPKEQIDEYSHLRDISDIITYENAKPGILIGQDNWHMLLTSKVRRGNRNQPIASLTPLGWVLHGGRTRTLGHHINYINHASETQEDDKIENLVKQYFAMDALCITPRRPKTDPEEQALRILNSNTVHTTDGRYETALLWKTDNVSLPDNYNNSLKRLINIENKLDRNLELKQKYTEQMEALVAKGYAEPAPKTKTENRTWYLPHFAVVNPLKPEKLRVVHDAAARTGGVALNYMLLKGPDVLQSLPGVIMRFRQHNIAVTADIKEMFIQVKLRPEDKDALRYLWRKDQRDDKPPEENRMTSLIFGASSSPSTAIYVKNLTAQKQEATHPEAAVAVQNRHYVDDYLDNFKTLKDAVHITKDFRRKHERKPTSKTFWTDSKIVLRWTRTGSRSYKPYVTQRLTAIEDSSTINGRRWLPTKHNVADDVTRDVPMSYQNEHKWLKGREFLRQRRDSWPTESATVTTTKLIDKVNIAAAAPAGASWPRRPDNVGRTVDLKGGVLRRPVRKLLILPIEEDHPAPRRMRLTRTAGVMCRTK

Summary

EMBL
L09635    AAA75005.1    AF530470    AAQ09229.1    RSAL01000375    RVE42106.1    + More
NWSH01005440    PCG64209.1    GEHC01000967    JAV46678.1    GEZM01052588    GEZM01052587    GEZM01052586    JAV74402.1    LNIX01000019    OXA44537.1    OXA44855.1    JXUM01136032    KQ568367    KXJ69026.1    GEHC01000956    JAV46689.1    LNIX01000015    OXA46575.1    LNIX01000003    OXA57597.1    GGFK01002635    MBW35956.1    GGFK01002641    MBW35962.1    GGFK01002631    MBW35952.1    LNIX01000004    OXA55408.1    GGFK01002609    MBW35930.1    KQ459986    KPJ18861.1    GGFK01002619    MBW35940.1    OXA55241.1    LNIX01000007    OXA52015.1    LNIX01000039    OXA39294.1    GEHC01000872    JAV46773.1    JXUM01111221    KQ565482    KXJ70922.1    AAAB01008847    GAMC01017930    JAB88625.1    JXUM01034199    KQ561015    KXJ80028.1    AAZX01014669    LN877231    CTR11689.1    GGFK01009497    MBW42818.1    JXUM01005879    KQ560203    KXJ83865.1    GGFL01001682    MBW65860.1    GGFM01003133    MBW23884.1    GGFL01001842    MBW66020.1    JAV74399.1    GGFJ01000302    MBW49443.1    JAV74401.1    GGFJ01000218    MBW49359.1    GGFL01001727    MBW65905.1    GEHC01000947    JAV46698.1    GGFJ01000402    MBW49543.1    GGFJ01000401    MBW49542.1    GGFL01005193    MBW69371.1    GDUN01000090    JAN95829.1    JXUM01127084    KQ567147    KXJ69602.1    GEHC01000914    JAV46731.1    GGFJ01000935    MBW50076.1    GGFK01008809    MBW42130.1    GGFJ01000432    MBW49573.1    GGFJ01000487    MBW49628.1    GEHC01000945    JAV46700.1    GGFJ01000333    MBW49474.1    GGFJ01000471    MBW49612.1    GGFJ01000470    MBW49611.1    JXUM01109099    KQ565290    KXJ71123.1    GGFJ01000306    MBW49447.1    GEHC01000955    JAV46690.1    LNIX01000012    OXA48116.1    OXA56382.1    GEHC01000921    JAV46724.1    ADMH02001934    ETN60411.1    LNIX01000027    OXA41945.1    JXUM01130316    KQ567562    KXJ69370.1    AAGJ04115911    NIRI01000132    RJW72731.1    NIRI01000534    RJW70389.1    DF142918    GAA48921.1    LSMT01001301    PFX12555.1    KL596795    KER24838.1    KL367480    KFD71819.1    JYDH01000001    KRY43517.1    KL367527    KFD66131.1    JYDW01000021    KRZ61212.1    KL367570    KFD63600.1    QNYJ01000054    RUA06460.1    KL367674    KFD60347.1   
Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF01565   FAD_binding_4
PF17921   Integrase_H2C2
PF09129   Chol_subst-bind
PF05585   DUF1758
PF00628   PHD
PF00078   RVT_1
PF17917   RT_RNaseH
PF01048   PNP_UDP_1
PF13855   LRR_8
PF18738   HEPN_DZIP3
PF01425   Amidase
Interpro
IPR005312   DUF1759        + More
IPR040676   DUF5641       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR041588   Integrase_H2C2       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR001841   Znf_RING       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR002999   Tudor       
IPR000048   IQ_motif_EF-hand-BS       
IPR000253   FHA_dom       
IPR041373   RT_RNaseH       
IPR003961   FN3_dom       
IPR035994   Nucleoside_phosphorylase_sf       
IPR000845   Nucleoside_phosphorylase_d       
IPR032675   LRR_dom_sf       
IPR001611   Leu-rich_rpt       
IPR041249   HEPN_DZIP3       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR023631   Amidase_dom       
IPR036928   AS_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF57756   SSF57756       
SSF50630   SSF50630       
SSF53167   SSF53167       
SSF75304   SSF75304       

Ontologies

Topology

Length:
906
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01479
Exp number, first 60 AAs:
0.00019
Total prob of N-in:
0.00069
outside
1  -  906
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
13.677437
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号