SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09910
Pre Gene Modal
BGIBMGA013783
Annotation
AF461149_1_transposase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.364 Nuclear   Reliability : 1.914
 

Sequence

CDS
ATGGAGTGGACGCTTAAAGAAGACCGTGTTGCAGTTATTGCGTTGCAGCGTTGCGGTTACGCGCCAATTCAAATTTTTAACATACTGAAAAATTTTAATATAACCAAAAGACTCGTTTATCGTACCATCAAACGATACAATGAAGACTCTAGTGTAGATGACAGGTCAAGAAGTGGTCGCCCTCGGTCTGTTAGGACTCCAGCAGTGATAAAAACTGTGAAGGCGCGAATTCAAAGAAATCCCAAACGTAAGCAGAAACTGTTGGCCCTTCAGATGGGGTTAAGCAGAACCACGGTGAAAAGGGCGTTAAATGAAAACTTAGGGCTTCGGGCATATCGAAGAAAAACAGGACATCGTTTGAATGCTCGTCTAATGGACCTGATACTGAAGAGATGCCGCGCTTTGTTGAAGCGGTACGCGGGAAAAAAATATCGGGAAATTCTTTTTTCGGATGAAAAAATTTTTACCGTAGAAGAGAGCTACAACAAACAAAATGATAAGGTGTACGCACACAGCAGTGAAGAAGCGAGCAACCGTATTCCGCGTGTCCAACGAGGTCATTTTCCATCCTCGCTCATGGTATGGTTGGGAGTTTCTTATTGGGGCTTAACAGAGGTACATTTTTGTGAGAAAGGTGAAAAAACGAATGCAGTTGTGTATGAAAATACAGTCCTGACGAACCCTGTGGAACCTATTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAAGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGGCTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGAAGGACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCTTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MEWTLKEDRVAVIALQRCGYAPIQIFNILKNFNITKRLVYRTIKRYNEDSSVDDRSRSGRPRSVRTPAVIKTVKARIQRNPKRKQKLLALQMGLSRTTVKRALNENLGLRAYRRKTGHRLNARLMDLILKRCRALLKRYAGKKYREILFSDEKIFTVEESYNKQNDKVYAHSSEEASNRIPRVQRGHFPSSLMVWLGVSYWGLTEVHFCEKGEKTNAVVYENTVLTNPVEPISHTMFNNRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHPNLESLKTSLIKAAADIDMDLVRAAIDGWPRRLKACIQNHGDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWKDLEEKACSKPHPNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLKACIQNHGGHFE

Summary

Similarity
Belongs to the TGF-beta family.
EMBL
AF461149    AAN06610.1    AB363028    BAG15927.1    AB363006    AB363010    + More
AB363014    BAG15923.1    BAG15924.1    AB473770    BAH20555.1    AB363018    BAG15926.1    RSAL01000191    RVE44681.1    RSAL01000012    RVE53510.1    RSAL01000063    RVE49524.1    RSAL01000022    RVE52367.1    RSAL01000392    RVE41996.1    JF779677    AEO90418.1    U47917    AAB47739.1    RSAL01000470    RVE41612.1    LNIX01000030    OXA41211.1    UYSL01019905    VDL71189.1    JARK01001345    EYC27589.1    JARK01000176    EYC41234.1    JARK01000059    EYC44525.1    DS268747    EFP00909.1    CAVP010059404    CDL95787.1    PDUG01000005    PIC23776.1    JARK01001411    EYC06502.1    JARK01001658    EYB84158.1    JARK01000255    EYC39473.1    DS268612    EFO94085.1    DS268508    EFO83264.1    PDUG01000006    PIC20538.1    DS268421    EFO88618.1    DS268492    EFP11689.1    PDUG01000012    PIC13506.1    DS268673    EFO98001.1    DS268525    EFO85497.1    DS268466    EFP06959.1    KX931010    APL98300.1    JARK01001337    EYC34439.1    PDUG01000001    PIC51673.1    DS268545    EFO88382.1    PIC28734.1    PDUG01000004    PIC32571.1    UYSL01020440    VDL74616.1    UZAH01029309    VDP05368.1    KN728607    KIH63514.1    PIC32570.1    UZAH01027257    VDO90094.1    DS268606    EFO93488.1   
Pfam
PF00019   TGF_beta        + More
PF07992   Pyr_redox_2
PF13358   DDE_3
PF00292   PAX
PF00250   Forkhead
Interpro
IPR009057   Homeobox-like_sf        + More
IPR001839   TGF-b_C       
IPR029034   Cystine-knot_cytokine       
IPR017948   TGFb_CS       
IPR015615   TGF-beta-rel       
IPR036188   FAD/NAD-bd_sf       
IPR023753   FAD/NAD-binding_dom       
IPR036388   WH-like_DNA-bd_sf       
IPR038717   Tc1-like_DDE_dom       
IPR001523   Paired_dom       
IPR036390   WH_DNA-bd_sf       
IPR001766   Fork_head_dom       
IPR030456   TF_fork_head_CS_2       
SUPFAM
SSF46689   SSF46689        + More
SSF57501   SSF57501       
SSF51905   SSF51905       
SSF46785   SSF46785       
Gene 3D
PDB
5HOO     E-value=6.42141e-12,     Score=171

Ontologies

Topology

Subcellular location
Secreted  
Nucleus  
Length:
442
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.25224
Exp number, first 60 AAs:
0.17211
Total prob of N-in:
0.01664
outside
1  -  442
 
 

Population Genetic Test Statistics

Pi
120.731249
Theta
57.103075
Tajima's D
3.467888
CLR
0.931049
CSRT
0.992400379981001
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号