SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09905
Annotation
PREDICTED:_uncharacterized_protein_LOC106708887_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.449 PlasmaMembrane   Reliability : 1.604
 

Sequence

CDS
ATGTCGGTGTCCTACATTCGCGGGAAGGTGACTAGTGAGCTCCGATGGTTCGCATCAGCTCATGCTTTGGTTGACAGAACGGATAGGGATGCGGCATTGCTCGATAGGGCGTCTCAGGTGCACGAACGGTTGGAGGTAGTGTACGATCGGTTGTCTGACCTCGTTGCTTTGGGGTCCGAAGTGGAGAAGGAGGTGATCCATGCCATCGGTCTTGACGTGGACCAGTGTCAGGAGTACGCTGATGCCATTCTGCAACGGGTGGCCGATATTAAGAAGCAGTCGGCTTCCGGTGGTAATGGAGGTTCGGGAACTTCGTCAGGCGTCATATCACGCCTCCCCTCCATCGACCTGCCGATCTTCCACGGTGATCTGAACGAGTGGGTCGGCTTTATAAATTTGTTTGACAGCCTGGTCCATGGTCGGTCGGACTTGACTGCCTCGTATAAGATGGCTCAGCTTCGGGGTGCTCTGCGAGGTGAACCTGGTGAATTGGTGGCACACTTGCCTATCACCAACGACAATTATGCGGTCGCACGCCAGATCCTGTTCGACCGATATCAAAATCAACGACGGTTGGTAGACGCTCAGCTGGCCAGGCTGTTTGCGATACCCAAACTTTCTCGGGCGTCCGATATCAGAACCGAGGTACTGAATCCAGTTACGGTGGCCACTAAGGCCTTGGGCAATTTGGGTCTACCAGTAGACCAATGGTCATATCTGCTCTTTTATATTGTTGCAGGTAGGCTGCCGGTTGAGGTGCTCACTCGCTTCGAGCAGCAGGACAACGCAGGTAGGGACGAACTGCCTACCCTGGCCAATCTGCTGGCATTTTTAGAAGCCGAAAGTCGCAGACACGAGATTATGCCACCACCCTCCTCTGGGTCGCGTGTGCCGGCTTCCGGCCACGCCGTTTCGGTTGCTCAGAGGGGAGGGGGAGGGGATAAGAGGGGGCCGTCTCAACGACTGACTGCGCTCATGGCAGCGGTGGGAGGCCCACGGTGTGCCTTCTGTCATGAGAGCGGGCACGACGTAGCCGCCTGTCCGAGGTTCCGGTCGACGCGCATCAGGGGTAGACGCAACATCGTTGCCCAGCGGCGATGGTGCTTTTTTTGTTTTGGGCCGCACACGGCGAGCGTCTGTCCACAGCCACAATTGTGCCCTAATTGCGACGGTCGGCACCATGCCCTCCTGTGTCTGGAGTCTGCCGCCACTCCGAGGTCATCCGGACGCAGTCATCTAGCCTCGCCGACCGGTGAGCGCACCGGTCGTAGCCCTCGCCAATTTGGCGGCGTGGACCCTCGGGAAGAGGCTTCGCAGGGAGGCGCCGGGTTAGGTACTGCGGGCGGGTGCCAGCGGATGCCCACTAGCTACGCCGGGGTGGCCACGTTGTCCCCCGTGCGGGGCCGTGTTCGCCTGCTGGATCGAGTAGCCCTGCTCACTCGTCTCCCCTTCCCTCAGAATGTTGCCCCAGCCCCAGAAGCTGTTTTACTTCCTACCGCTTCTGTTCGGGTGTTGGATTCGGATGGCAACACTGTGTTTGCTCGAGCTCTGTTGGATTCCGGCGCACAGGGCAGTATTATGTCGAGCAACCTTGCAGTACGGTTGGGCAATCCTATTTACAAGTCTTCTTATTCTATTCGTGGAGTGGGCAATGTTAGAATTTCGGACGTGATCGGTCACACTTCATTTATTTTCTCATCGAATCCCAACCCTCGCTTACAGTTTAGAGTCTCAGCTTTGGTGATGCCTGAGGTGATAGGTCGTCACCCTCCGGTGAAGGTAAACAGTTACATACGGTCATTGACTTCAGACTTACGGCTAGCGGACCCCAAGTTTGACACCCCGGGGCCAGTAGACGTACTACTTGGGGCGGATGTACTAGGGAAGCTGCTCCTGACTGGGAAGCGCGTTCTTCATGCGGAGGGTTTGGTTGCAATGGACACAAAATTAGGGCATGTATTGTTGGGTCCTGCGTTCCGGCCGGTCGCTGCGAGGAAATCGGACAATTTTCTGGTCGGGTCTACGCTTTCGGAAGTAGTCCAACGGTTTTGGGAACTAGAAGAACCTCCTACAGCTTATCGAGTTAACCCGGATGAGGAGGAATGTGAGCTGTTTTACCAGAATAATACGGGTCGTCTCTATTCGGGCCGGTTCTTGTTAAGACTTCCTTTTCGGGCGAATCGCCCACTGCTAGGCAGTTCGAGGAAGGCAGCAGAGACTAGACTTTTGTCAATGGAGAGACGCATGAGGCGCGACGCGGTGTTCCGGCAGAAATATGTAGAGTTTATGCGGGAGTATGAATCCTTAGGTCACATGTCGGTTTCCAAGGTAGATTGGAGTGCTACGGAGCACTGTTTCCTGCCTCATCATGCGGTTTTGAAAACTCCTAACGGTAAAATTAGGGTCGTGTTTGACGGTTCGGTCACGACCTCCTCCGGCGTCTCGTTAAATCAGTGTCTCCATTCGGGTCCAAAGCTGAACCGGGACATTTCAGACATACTGACGAGCTTCCGCAGGCACCAGATCGTTTTCGTGGCAGACATCCGTATGATGTTCAGGCAAACGGTGATTCATCCGGAGGATAGGCGGTATCAACTCATTCTCTGGCGTGAAAGCTCAGATGAGCCCATAAAAATTTATGAACTGAACACGAACACTTACGGGTTGCGGTCGAGTCCATATTTAGCGGTTCGTTCTTTGCGGGAGTTGGCAGTGAGGGAACGGTTGCACTACCCTCGTGCTGCGGACATTTTGGAACGGGATCTATATGTCGATGACGTATGTACGGGCGCCGACAGTGTCGAAGAGGCCTTATCACGCAAGGATGAACTGATCCGCCTTTTGAGCAGGGGCGGGTACGAGTTGAGAAAATGGCTGTCTAACTGTCCTGAGTTGTTGACTGGTTTGCCAACGGAGTTTCAACAGGATCCCCATCTTTTCGAGAATGTCGATAACCCTAACATGCTGTCGGTCCTAGGGATTCAATATCGTCCGATTCAAGACGAATTTACCTATCGGGTGGAGTTGGAAAATCCAAAGGTATGGTCTAAGCGAACGGTGCTTTCCACAATTGCTCGAACCTTCGATCCAAACGGTTGGATCGCTCCTGTCACTTTTCTCTTAAAGTGCTTCATGCAGCGACTGTGGTCTGCTAACCTGTCATGGGACGAGGGGATTGCTGGTGACCTATTGAAGGATTGGTTGAACTTTTTCTCGTCTCTTCCTGATATTAACCACGTGTCAATACCTCGGAAGCTGGTTCCTGCGGGCAAATACAAGGCGTCTCTCCACGGGTTTTCGGATGCCTCGGAACGTGGATTCGCAGCTGCGGTATACTTGCGAACGGTTTCTTCAACTGGAAGGGTTGATATACGGTTGGTGTTAGCGAAGAGTAAGGTCGCTCCGCTTCGGACACGCATGACGATTCCGAAGCTCGAGTTGTCTGGTGCCGCTCTGTTGACTAGGTTGTTAAACCATACAGCTACTAGTTTACGGTCGGTTATTGATTTAGAAAACACTGTCTATGCTTGGACAGACAGCCAGATAGTGTTATGCTGGTTGAAGGCTTCGGTTCATACACTTGAAGTTTTCGTGGCCAACCGTGTCTCCCAGATTCAAGGTTCTGAGGTCCCTCTAACATGGAGACACGTGCCTGGTGAGCTCAATCCGGCGGACTGCGCTTCTCGGGGATGCTTAGCATCGGAAATAGTTGATCATCAGTTATGGTGGGGTCCCCAGTGGCTCACCATGAAGGCTTCTCAGTGGCCTCCCTCTCGCATAGAAGTTCCTCCAGGTCTCGTGGCTGCACCGGCGCAGTTCGAGGATCGAGGAGTGATTCAGGGGTTGGATTTGGATCTGCTCATCAACCGTTATAGCTCCTTGGACAAGCTGGTTAAGGTTACCGCCTGGATTTTGAGGTTTATTCGGAATTGTCGTTTGTCGGTGTCTCAACGCAATATGACACCTGTTGTGTGTCCCATCGAGCGGAAGAAGGCGCTGCTGAAATTAATTGAAGTTGTGCAAGCCACCAGCTTTCATTCAGAATTGAAGGCGCTAAGGACTGAGCGCCCTAAGCTTCGTGGAGCTATCGCTCGTCTTAGCCCCTTTGTAGACGGCCAGGGGTTGATTCGAGTGGGAGGTAGATTAAGTAACTCAAATTTACCTTATTCGGCGCGCCATCCCCTTTTACTTCCCAAGAAAAGCCAGTTAGTTGACCTGTTGGTGATGGATCGCCACATCGCAAATTCGCATTCCGGTTGCAATGCGCTGTTGGCATCCCTCCAGAGGGAATTTTGGATTCTGTCAGGGCGTCGTACCGTTCGGAGCGTCCTTTTCCGGTGTTTACCCTGTTATCGGCTTAAGGCGTCTACGATGCAGCCTCAGATGGGAGATCTGCCTCCAGACAGGGTGAAGAAGATGAGGCCGTTTTCTGGAGTTGGTACGGACTTCGCTGGGCCTTTCATGATCAAGGCTTCACGTTTGCGGAATGTTAGGTTAATTAAGGCTTATCTGTGCGTCTTTGTCTGCCTTTCAACCAAAGCTGTACATCTTGAAGTTGTTGCCGACCTTACAACTGAAGCCTTTATTGCGAGCTTGGATAGATTTGTGTCCCGTCGAGGCTTACCCGAATTGATACGCTCCGATAACGGAACGAATTTTGTAGGTGCGGACCGTTACTTGCGGGATGTAGTAAATTTCTTGAACAATAACCAGGTGGATATTGAAACGGCCCTCTCTCGTCGCGGTATTCGGTGGACCTTCAGTCCTCCAGGATGCCCCCACTGGGGTGGAATTTTCGAGGCAGTAGTAAAATCGGCTAAGACTCACTTGATGCGCGTGATAGGGCAAACCTCGCTCACCTTTGAGGAGCTAACTACGATATTTTGTAAAATTGAAGCGGTACTTAATTCACGGCCGTTGTGCCCGCTCAGTTCAGACCCGAATGACTTGGAGTCGTTAACTCCAGGCCATTTCTTGATAGGACAGCCACTCAATGCGTTGCCGGAGTATCCCCTCTCGGATATCAAGCCTGGACGGTTGAGGCGATACCAGCTGTTGCAGCAGATGTCCCAAGATTTTTGGAAACGTTGGTCCCTTGAGTATTTACATCTGCTCCAGCAGCGCTTTAAGTGGACGGATAGAACCAGTCCCCCTCACGTCGGTGACCTTGTGTTGGTTAAGGATGCTAACCTGCCGCCACTGCGTTGGCGTAGGGGGCGCATTGTTAATCTGTTTCCCGGTAAGGATGGGACCCCTCGGTCTGCAGAGGTTCTGGTCGGGGACTCGGTTCTCAAACGAGCGGTCACAACGTTGTCCCGGCTGCCAGTTGATTAG
Protein
MSVSYIRGKVTSELRWFASAHALVDRTDRDAALLDRASQVHERLEVVYDRLSDLVALGSEVEKEVIHAIGLDVDQCQEYADAILQRVADIKKQSASGGNGGSGTSSGVISRLPSIDLPIFHGDLNEWVGFINLFDSLVHGRSDLTASYKMAQLRGALRGEPGELVAHLPITNDNYAVARQILFDRYQNQRRLVDAQLARLFAIPKLSRASDIRTEVLNPVTVATKALGNLGLPVDQWSYLLFYIVAGRLPVEVLTRFEQQDNAGRDELPTLANLLAFLEAESRRHEIMPPPSSGSRVPASGHAVSVAQRGGGGDKRGPSQRLTALMAAVGGPRCAFCHESGHDVAACPRFRSTRIRGRRNIVAQRRWCFFCFGPHTASVCPQPQLCPNCDGRHHALLCLESAATPRSSGRSHLASPTGERTGRSPRQFGGVDPREEASQGGAGLGTAGGCQRMPTSYAGVATLSPVRGRVRLLDRVALLTRLPFPQNVAPAPEAVLLPTASVRVLDSDGNTVFARALLDSGAQGSIMSSNLAVRLGNPIYKSSYSIRGVGNVRISDVIGHTSFIFSSNPNPRLQFRVSALVMPEVIGRHPPVKVNSYIRSLTSDLRLADPKFDTPGPVDVLLGADVLGKLLLTGKRVLHAEGLVAMDTKLGHVLLGPAFRPVAARKSDNFLVGSTLSEVVQRFWELEEPPTAYRVNPDEEECELFYQNNTGRLYSGRFLLRLPFRANRPLLGSSRKAAETRLLSMERRMRRDAVFRQKYVEFMREYESLGHMSVSKVDWSATEHCFLPHHAVLKTPNGKIRVVFDGSVTTSSGVSLNQCLHSGPKLNRDISDILTSFRRHQIVFVADIRMMFRQTVIHPEDRRYQLILWRESSDEPIKIYELNTNTYGLRSSPYLAVRSLRELAVRERLHYPRAADILERDLYVDDVCTGADSVEEALSRKDELIRLLSRGGYELRKWLSNCPELLTGLPTEFQQDPHLFENVDNPNMLSVLGIQYRPIQDEFTYRVELENPKVWSKRTVLSTIARTFDPNGWIAPVTFLLKCFMQRLWSANLSWDEGIAGDLLKDWLNFFSSLPDINHVSIPRKLVPAGKYKASLHGFSDASERGFAAAVYLRTVSSTGRVDIRLVLAKSKVAPLRTRMTIPKLELSGAALLTRLLNHTATSLRSVIDLENTVYAWTDSQIVLCWLKASVHTLEVFVANRVSQIQGSEVPLTWRHVPGELNPADCASRGCLASEIVDHQLWWGPQWLTMKASQWPPSRIEVPPGLVAAPAQFEDRGVIQGLDLDLLINRYSSLDKLVKVTAWILRFIRNCRLSVSQRNMTPVVCPIERKKALLKLIEVVQATSFHSELKALRTERPKLRGAIARLSPFVDGQGLIRVGGRLSNSNLPYSARHPLLLPKKSQLVDLLVMDRHIANSHSGCNALLASLQREFWILSGRRTVRSVLFRCLPCYRLKASTMQPQMGDLPPDRVKKMRPFSGVGTDFAGPFMIKASRLRNVRLIKAYLCVFVCLSTKAVHLEVVADLTTEAFIASLDRFVSRRGLPELIRSDNGTNFVGADRYLRDVVNFLNNNQVDIETALSRRGIRWTFSPPGCPHWGGIFEAVVKSAKTHLMRVIGQTSLTFEELTTIFCKIEAVLNSRPLCPLSSDPNDLESLTPGHFLIGQPLNALPEYPLSDIKPGRLRRYQLLQQMSQDFWKRWSLEYLHLLQQRFKWTDRTSPPHVGDLVLVKDANLPPLRWRRGRIVNLFPGKDGTPRSAEVLVGDSVLKRAVTTLSRLPVD

Summary

EMBL
LNIX01000007    OXA51795.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    + More
GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    LNIX01000016    OXA46198.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    ABLF02030698    ABLF02030705    ABLF02030709    LBMM01008464    KMQ88855.1    ABLF02054908    ABLF02005684    GGMR01010723    MBY23342.1    KK114194    KFM61875.1    ABLF02041614    ABLF02008636    ABLF02065931    ABLF02035780    ABLF02039606    LBMM01009888    KMQ87813.1    GGMS01010524    MBY79727.1    LNIX01000002    OXA60848.1    ABLF02030854    ABLF02067347    LBMM01009202    KMQ88311.1    LBMM01010417    KMQ87475.1    GGMS01014951    MBY84154.1    GEZM01085145    GEZM01085143    JAV60187.1    ABLF02015138    GEHC01000869    JAV46776.1    ABLF02022040    ABLF02056888    LNIX01000005    OXA54454.1    GEBQ01000825    JAT39152.1    ABLF02008594    ABLF02028666    ABLF02066713    OXA59522.1    LBMM01009645    KMQ87967.1    ABLF02023842    ABLF02028949    ABLF02058391    GBRD01007977    JAG57844.1    GGMS01006636    MBY75839.1    GEZM01054765    JAV73413.1    GGMR01006575    MBY19194.1    LNIX01000069    OXA36894.1    GALX01004947    JAB63519.1    GBBI01004479    JAC14233.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    ABLF02041670    GGMR01005823    MBY18442.1    GEZM01012999    JAV92824.1    GFTR01008874    JAW07552.1    GEBQ01015458    JAT24519.1    GEZM01066272    JAV68024.1    GEHC01000870    JAV46775.1    LNIX01000036    OXA39969.1    LBMM01008324    KMQ88972.1    GGMR01004029    MBY16648.1    GEHC01000864    JAV46781.1    ABLF02021785    GGMR01009860    MBY22479.1    GEZM01054789    JAV73399.1    GGMR01014351    MBY26970.1    ABLF02041863    GGMR01014306    MBY26925.1    LBMM01010405    KMQ87487.1    GBHO01044316    JAF99287.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    ABLF02006304    ABLF02036268    LBMM01009964    KMQ87756.1    GBBI01004387    JAC14325.1    GBBI01004386    JAC14326.1    GBHO01009080    JAG34524.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    QOIP01000009    RLU19024.1    GGMR01002024    MBY14643.1    GBBI01004408    JAC14304.1    GBBI01004410    JAC14302.1    GGMR01018294    MBY30913.1    LBMM01009863    KMQ87831.1    GGMR01000448    MBY13067.1    ABLF02003736    ABLF02008292    ABLF02008294    ABLF02046909    ABLF02052378    ABLF02023723    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    GGMR01020322    MBY32941.1    GGMR01016460    MBY29079.1    CR954257    CAJ14165.1    NWSH01001945    PCG69607.1    JXUM01113346    KQ565681    KXJ70776.1    EF426679    ABP48078.1    ABLF02041599    JXUM01030959    KQ560903    KXJ80414.1    ABLF02041590    ABLF02025193    LBMM01009551    KMQ88039.1    ABLF02018588    ABLF02018590    ABLF02042430    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GGMR01002187    MBY14806.1    GGMR01013370    MBY25989.1    ABLF02034704    ABLF02034708    ABLF02034709    ABLF02044644    ABLF02055319    LBMM01006490    KMQ90572.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF03564   DUF1759
PF00665   rve
PF05380   Peptidase_A17
PF18701   DUF5641
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00078   RVT_1
PF09337   zf-H2C2
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR001584   Integrase_cat-core       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR036875   Znf_CCHC_sf       
IPR015416   Znf_H2C2_histone_UAS-bd       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
5UOQ     E-value=0.0848846,     Score=90

Ontologies

Topology

Length:
1777
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01681
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00063
outside
1  -  1777
 
 

Population Genetic Test Statistics

Pi
304.164283
Theta
177.692517
Tajima's D
2.107653
CLR
0.049355
CSRT
0.894405279736013
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号