SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09889
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
ATP-dependent DNA helicase      
Location in the cell
Cytoplasmic   Reliability : 1.379 Mitochondrial   Reliability : 1.022
 

Sequence

CDS
ATGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCAGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCGCAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLAQALAL

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
FAD
Mg(2+)
Similarity
Belongs to the FBPase class 1 family.
Belongs to the GMC oxidoreductase family.
Belongs to the helicase family.
EC Number
3.6.4.12
EMBL
AB090825    BAC57926.1    AB126050    BAD86650.1    LBMM01009501    KMQ88083.1    + More
LBMM01005707    KMQ91279.1    LBMM01016102    KMQ84557.1    QOIP01000014    RLU15083.1    RSAL01000009    RVE53812.1    LBMM01006538    KMQ90523.1    KZ149922    PZC77701.1    QOIP01000009    RLU18544.1    KZ149950    PZC76665.1    ODYU01003322    SOQ41921.1    KZ149896    PZC78733.1    AB078935    BAC06462.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    QOIP01000004    RLU23632.1    QOIP01000060    RLU14687.1    KZ150386    PZC71062.1    KZ149918    PZC77857.1    KZ150308    PZC71477.1    AB078930    BAC06454.1    AB078931    BAC06456.1    RSAL01000006    RVE54258.1    ODYU01007528    SOQ50378.1    LBMM01012027    KMQ86470.1    LBMM01003001    KMQ94089.1    AB078929    BAC06452.1    RSAL01003504    RVE40273.1    RSAL01000109    RVE47213.1    PZC77700.1    LBMM01006909    KMQ90209.1    RSAL01000014    RVE53298.1    ODYU01006757    SOQ48893.1    LBMM01003679    KMQ93242.1    LBMM01008861    KMQ88580.1    LBMM01006022    KMQ91008.1    LBMM01009494    KMQ88097.1    GL450953    EFN80213.1    LBMM01001564    KMQ96079.1    RSAL01000481    RVE41577.1    D85594    BAA19776.1    LBMM01006954    KMQ90166.1    ODYU01009945    SOQ54696.1    ODYU01005282    SOQ45985.1    RSAL01000080    RVE48661.1    LBMM01005733    KMQ91252.1    LBMM01024024    KMQ82631.1    LBMM01006996    KMQ90129.1    LBMM01008682    KMQ88705.1    ODYU01006342    SOQ48109.1    ODYU01004308    SOQ44039.1    QOIP01000002    RLU25407.1    LBMM01006657    KMQ90417.1    RSAL01001432    RVE40790.1    LBMM01004272    KMQ92618.1    LBMM01012797    KMQ85990.1    ABLF02006132    QOIP01000007    RLU20280.1    LBMM01006671    KMQ90407.1    LBMM01005634    KMQ91349.1    ODYU01005115    SOQ45661.1    QOIP01000012    RLU16027.1    ODYU01004693    SOQ44845.1    LBMM01019838    KMQ83439.1    ODYU01008140    SOQ51495.1    LBMM01003452    KMQ93523.1    QOIP01000031    RLU14697.1    LBMM01019839    KMQ83438.1    QOIP01000013    RLU15211.1    LBMM01006662    KMQ90413.1    QOIP01000003    RLU25053.1    QOIP01000010    RLU18098.1    GGMR01011974    MBY24593.1    ABLF02026677    ABLF02032994    ABLF02059021    ABLF02064578    LBMM01006534    KMQ90528.1    GGMR01010769    MBY23388.1    LBMM01004152    KMQ92762.1    LBMM01032197    KMQ81741.1    LBMM01015018    KMQ84954.1    LBMM01004906    KMQ92001.1    LBMM01008349    KMQ88951.1    ABLF02017307   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF00316   FBPase
PF01421   Reprolysin
PF07776   zf-AD
PF00096   zf-C2H2
PF03372   Exo_endo_phos
PF00732   GMC_oxred_N
PF02949   7tm_6
PF05970   PIF1
PF00059   Lectin_C
PF00650   CRAL_TRIO
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR033391   FBPase_N       
IPR000146   FBPase_class-1       
IPR028343   FBPtase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR004117   7tm6_olfct_rcpt       
IPR016187   CTDL_fold       
IPR010285   DNA_helicase_pif1-like       
IPR016186   C-type_lectin-like/link_sf       
IPR001304   C-type_lectin-like       
IPR018378   C-type_lectin_CS       
IPR027417   P-loop_NTPase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR001251   CRAL-TRIO_dom       
IPR036865   CRAL-TRIO_dom_sf       
IPR036273   CRAL/TRIO_N_dom_sf       
IPR012337   RNaseH-like_sf       
IPR006759   Glyco_transf_54       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF51905   SSF51905       
SSF52540   SSF52540       
SSF56436   SSF56436       
SSF57756   SSF57756       
SSF52087   SSF52087       
SSF46938   SSF46938       
SSF53098   SSF53098       

Ontologies

Topology

Length:
160
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00461
Exp number, first 60 AAs:
0.00235
Total prob of N-in:
0.11422
outside
1  -  160
 
 

Population Genetic Test Statistics

Pi
192.569891
Theta
114.314203
Tajima's D
2.873196
CLR
0.243456
CSRT
0.972701364931753
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号