SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09888
Annotation
PREDICTED:_uncharacterized_protein_LOC101739096_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.651
 

Sequence

CDS
ATGTACCGACGTGACGAGCTTACCCCTGCCGAGCGGCCGTTCAGGGGCACTGCGGCCCTCGTCAGGCGGGACGTGGTGCATGATCAGTTGGATTTGCTGTCCTTCACATCGACAAGGTCGGTCGGTGTGAGGGTACACACCTCGGGGGGGGATATGCGGATTTATGCCGCGTATAGACCCCCGGGGCCTGAATTTCACCCTGAGGACATAAGACGGGCCCTGAATCACGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTTAACTCAGCGGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCCGTGGTCGGCCCCGACGAACCCACACACGTCCCGACCGCCGCGCGCTATCAGCCCGATGTGCTGGACGTGTGTGTGCACAAGGGGCTACGGTGCCCCGTAACGATCGAGGCACTGTACGACCTGGGTACCCCACATCTCCCTATCCTGGTGACACTGGGAATGGGGCTCACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGACTAGTCGACCTTCCCGTGATTCAGGACCCCAACACCCCTGATGGGGTCGACGATGCGGCAACCCGCCTTGTTGACTCCATCAGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAGGCGATTATTCGCCGGAAGAGGGGCTTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATAAAGCGCGAGCTTAATGAACTGGAAGCGGAGCTGGCGACAAAGATTAGCACCTTCCGGGGCTATGCCTGGCAGGAGAGGATCGAGGAGGCCCGCGAGGACCCCTCCTCAGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGAAATGCTGGAGCGGACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCGCAGGGGAGCGTCCTGGCACCATTCCTCTACGCTCTCTATACCAACGATATTCCCACGCTCGAGGGAAACCTCGAAGCCTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCGCGTCATCCAACTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGTTATTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAATACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAATAAGGCGTTGGCGGCCGCTCGCTACGCGAGATTCCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGGTCACGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGTAATGCCGTAATCGCCCGGGATCTGGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATCTTTACGAGCGGGCTGACGGTGGACCCCTCGAGCATCTCCACAATTTAGCTCCCTTGCACGCTAGACCACCTGATGGTCTGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MYRRDELTPAERPFRGTAALVRRDVVHDQLDLLSFTSTRSVGVRVHTSGGDMRIYAAYRPPGPEFHPEDIRRALNHDSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHVPTAARYQPDVLDVCVHKGLRCPVTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRRLVDLPVIQDPNTPDGVDDAATRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELATKISTFRGYAWQERIEEAREDPSSGQPMLLGSGPRRCPGRNAGADLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPFLYALYTNDIPTLEGNLEAWEADVKLALFADDSAYFASSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGNTAAILFGPVRTRVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHANKALAAARYARFLLRPVLASRLPVRTKLGIYKTYVRSRITYAAAAWYHLIPQVTRVKLQAQQNLALRTIVGAGRYVSNAVIARDLDVESLEEFIRRLARNLYERADGGPLEHLHNLAPLHARPPDGLALPRELLEPPAMVR

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
614
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0408299999999999
Exp number, first 60 AAs:
8e-05
Total prob of N-in:
0.00233
outside
1  -  614
 
 

Population Genetic Test Statistics

Pi
454.9698
Theta
212.222398
Tajima's D
3.809262
CLR
0.248026
CSRT
0.998650067496625
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号