SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09865
Annotation
ORF_B_(bases_1850-5560)_first_start_codon_at_2306_[Autographa_californica_nucleopolyhedrovirus]
Location in the cell
Nuclear   Reliability : 3.519
 

Sequence

CDS
ATGGCCGTAGACCCGGACCAAATCTACAAGGCCCTTCGCCCAGTGCCAGAGTTCGACGGCAATCCGAACATACTGACTAGGTTTATCAGAATTTGTGACCAAATCGTCACACAGTATATAAGAACAGATCCTGGCAACGAATTAAATAACCTCAGCCTGATAAACGGTATATTAAATAAAATAACTGGTCCTGCCGCCAGGACCATAAATTCAAACGGCATACCAGAGAACTGGTTAGGTATCCGTACTGCCCTCATTAATAATTTTTCAGACCAAAGAGATGAGACCGCTTTGTACAATGACCTCTCCTTACTAACACAGGGAAACAGTAGCCCCCAGGAGTTTTACGACAAATGCCAGACCCTATTCAGCACTCTCATGACATACGTAACTTTACACGAAAGCATTGCCACAACCATCGAGGCAAAACGCGACTTGTATAAAAAGCTAACAATGCAAGCATTTGTTCGAGGCCTCAAGGAACCCTTGGGATCTCGCATACGCTGCATGAGACCGACCTCCATTGAAAAGGCTCTGGAATTTGTACAGGAAGAACTTAACATAATGTATCTACAACAGCGAAACGGGTTCACCTCTGAACGGCGCAACCTTATTCAGCCTACACCGACACCACCTGTAAAAATACCACATATGTTTCCGGTAGCAATGCCGAAACCGCTTTCATTCGGACCGAACCCAGGACCGAGCTGGGAGCGACAGCCACCACCAGGACCTAACAACCACTGGAAACCTGCCTTCAAATTTAACGCCCCTCAGCGCATGCCTAACATGCCATCACGCACGCAGCAAATGTTCGCATCGCACCCACCAAACTACAACCCCCGTAGCAACGTATTTAGGCTACCTCAGCGGAACCAGGGACCGAAACCTATGAGTGGTATTAGTCACTACGTGGCAAAACAACTTCCACTCACAGGTCATGATTGGAACCTGCTGACTAAATGGAAATCTAGAATCGACCTTAAAGACAACTTACTGATTACAGACAATTCTACCAACCCTATTGAAATGTTCAATTCTCGCAACGTCAACCTGTACGAAGACATCGTACCGGCTAACTCTAGTAAACTAGTTAGAGTACCAATAAATTCATCTGACGGCGAAGTCTATATCCCGCAGCAATATCTGAACAACTGTGTGGTGAACGAATGCATCACGACAGTCGTTAAAAACCGTGTGGTCGGAGACATCAAAAAACGACCCGTTGTCAGTAAGCCATTTGAAACGCACACTCGCATATCTATACAAGTTTCTCAATCAAACTTAAGAGAGGACATCATAAACGCCATTAAAGAATTCGTTAATCCTAAAGTAAAAACTGGCCTCCTTATTAATCCAACATTAAGCATGTACGACATTATACCCATAATTCAAGACACGTTCAGAAATTCAGCAATGAACCTCCTACTCACAAAGGTGGAATTAGAAAATGTGAAAGAGTACCTTCGGCAACAAGAAATAATAAGCCACTATCACGATGGAAAAACTAACCACCGCGGAATAAATGAGTGTTATTTAGCTCTTTCGCGAAAATATTACTGGCCGAAAATGAAAGATCAAATTACAAAATTCATAAACGAATGTACTATATGCGGACAAGCTAAATACGATCGCGCACCCATTAAACAGCAGTTTAGCATAGTACCACCCCCGAAGAAACCCTTCGAAATAGTTCATATGGACTTGTTCACCGCCCAATCCGAAAAATACCTGACATTTATTGACGTATTCTCTAAGTACGGACAGGCTTACCTGTTGAGAGACGGCACAGCAATTAGCGTATTACAGGGTCTATTGCAGTTTTGCACGCATCATGGTCTACCTTTAACGATAGTAACTGATAATGGTACAGAATTCACAAACCAATTGTTTTCCGAATTCATACGACTTCACAAAATAAATCATCATAAAACCCTAGCACACACACCTCATGACAATGGCAATGTAGAGAGATTCCATTCAACCTTGCTAGAACACCTTCGCATACTTCGCTTACAACATAAAAATGAACCTGTAATAAACTTAATGCCTTATGCAATATTAGCTTACAACAGTTCAGTCCATAGTTTCACCAAGTGTCGCCCTTTTGACATCATAACGGGACACTTTGACCCTAGAGACCCTCTCGACATTGACATAACAGCCCATTTACTGCAACAGTACATGGAATCACATAAAGCTCAAATGACTACAGTTTATGAACTCATCAATGAAACCTCACTTGCTAACCGTACATCGCTCATTGAAAATAGAAATAAGAACCGCGAACCAGAAGCGACGTACCAGCCTAACCAACAAGTTTTCATTGAAAACCCGATAGCAGCCCGACAAAAAACAGCCCCGAGGTACACTCAAGATAGAGTGCTAGCAGACTTACCAATTCATATCTACACATCGAAAAAACGAGGCCCTATTGCTAAATCCCGACTTAAACGTGCACATAAAGACTTCCGATTGTTACAGGATTCTACTGAACCTCCTGACCCAACATCTGACGACCGCACACGAGATAAAACTTGA
Protein
MAVDPDQIYKALRPVPEFDGNPNILTRFIRICDQIVTQYIRTDPGNELNNLSLINGILNKITGPAARTINSNGIPENWLGIRTALINNFSDQRDETALYNDLSLLTQGNSSPQEFYDKCQTLFSTLMTYVTLHESIATTIEAKRDLYKKLTMQAFVRGLKEPLGSRIRCMRPTSIEKALEFVQEELNIMYLQQRNGFTSERRNLIQPTPTPPVKIPHMFPVAMPKPLSFGPNPGPSWERQPPPGPNNHWKPAFKFNAPQRMPNMPSRTQQMFASHPPNYNPRSNVFRLPQRNQGPKPMSGISHYVAKQLPLTGHDWNLLTKWKSRIDLKDNLLITDNSTNPIEMFNSRNVNLYEDIVPANSSKLVRVPINSSDGEVYIPQQYLNNCVVNECITTVVKNRVVGDIKKRPVVSKPFETHTRISIQVSQSNLREDIINAIKEFVNPKVKTGLLINPTLSMYDIIPIIQDTFRNSAMNLLLTKVELENVKEYLRQQEIISHYHDGKTNHRGINECYLALSRKYYWPKMKDQITKFINECTICGQAKYDRAPIKQQFSIVPPPKKPFEIVHMDLFTAQSEKYLTFIDVFSKYGQAYLLRDGTAISVLQGLLQFCTHHGLPLTIVTDNGTEFTNQLFSEFIRLHKINHHKTLAHTPHDNGNVERFHSTLLEHLRILRLQHKNEPVINLMPYAILAYNSSVHSFTKCRPFDIITGHFDPRDPLDIDITAHLLQQYMESHKAQMTTVYELINETSLANRTSLIENRNKNREPEATYQPNQQVFIENPIAARQKTAPRYTQDRVLADLPIHIYTSKKRGPIAKSRLKRAHKDFRLLQDSTEPPDPTSDDRTRDKT

Summary

Uniprot
ProteinModelPortal
PDB
3S3O     E-value=1.13748e-07,     Score=137

Ontologies

Topology

Length:
846
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02574
Exp number, first 60 AAs:
0.00073
Total prob of N-in:
0.00071
outside
1  -  846
 
 

Population Genetic Test Statistics

Pi
281.479408
Theta
208.98882
Tajima's D
3.600615
CLR
0.489181
CSRT
0.994650267486626
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号