SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09864
Annotation
PREDICTED:_uncharacterized_protein_LOC101745010_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.787
 

Sequence

CDS
ATGGAGTCGTTAGTAGTAGATAAAATTACTGAACGTTTACCGACTACCACAGTTGATGCCTCTCTTTTATCGAATTTCGAAGACATAGCATTGGCAGACGATACTTACTTTAACCCAGGCCCGATCCAACTGTTGATTGGAGCTTCGATTTTCCCGCATCTGCTCTTATCGAACAAGGTTCAAGGACGGCCTTCGCATGCCTCGCCGATCGCGTTAGAGACTATCCTCGGTTATGTTATTGTTGGTGACGCTCCCGTTCGTGTAGCTAGCAACGAGAGCGTTTCATATTGCTGTACCGGAGACCCGTTAGACTCCACAATTCGGAAGTTTTGGGAATTAGAGGAGGTAGACGTGCCGTTTGTATTCAGCCCCGAGGACAAAATGTCTGAGGAGTTTTATACCAGTACTACCACACGAGATAGTGACGGACGATACGTGGTGGCTTTGCCCTTTAAAGGTGATGTTAACACTCTCGGTAAATCGCGTCAAGCAAGTGAAAATCGATTTTACTGCTTAGAAAGAAAGATGCAAGCTTCTCCGCAACTAAAATTAGCGTACGACAACATCATTCTCGAATATTTAGAGAAGAACTATCTCTCAGCTGTAGATTGTGACAGTTCAGATATTTCTTATTTTATTCCGCATCATGGTGTAATCAGACAAGATAAGGTCACAACCAAATTAAGAGTCGTACTCGATGGTAGTTGTAAGACTACTACTAATGTTTCGCTCAATGATCTGTTATATCGTGGACAAAATTTCCAAGGAAATTTATTTAATATTATTATTAATTTTCGTTTGTTTCCGGTTGCCCTTTCCGCTGACATTCGTCAGATGTTTCTGAGTATTGGAGTCAGAGAATCTGACAGGCGTTTTCAACGCATTCTATATCGTTTTTCTCCTCAACAACCATTACAAGTTTACGAATTTAATCGTGTAGTTTTCGGGCTTAAGTCTAGTCCTTTTCATGCGTTGCGTACTATTAAACAGCTGGCAGCTGATGAAGGTGTCGCTTACCCGCGGGCCAGAGAAATTATTGATACTAGCCTATATATGGACGATTTTGTTTGTTCAATTCCAACTGAAGACATCGGCATATCGACCGCTTCTGATATGATAGGTCTCATGAAGGCCGGTCAGTTCGAGCTGGTGAAGTGGATGAGTAACTCACAAGTAGTGTTAGATTCGATCCCGCCGTCGCATCGCCTGCCAGGTGTCAAGGAGTTCGATGAGTCGAACCAGCATAAAGTACTCGGCTTGTGTTGGTCTCCTACGTCGGACAATTTTTGTATAAAAATTGACACTCCGATTGAAATTTGTACTAAACGTACAATACTGTCATGTGTTGCTAAAATATGGGACGTCATGGGATTTGTCGCACCGGTCGTCCTGTTCGTTAAACTTATTATTAAGCAGTTGTGGCTGAGCAATTGCGACTGGGATGACACTCCATCCGAAGATATAGTAAAAATGTGGAGCCGATTCAAAGAAGAACTTCCTTTGCTTTCTCGTATAAAGATCCCACGTCACGTAGGTATGAACGTCGACAGCATCGCGACTATCTTAGGTTTCGCGGACGCCAGTGAGAAAGCATATGGGGGGGTGATATATTTTCACGTTCAAAATAACAATGATAATACAATACGCTTGATAACAGCAAAATCAAAGGTTTCTCCTAAAAAGGTTGTGTCGCTCGCCAGACTTGAGCTTTGCGCGATTCTCATACTCGCTCAGCTTATAAAAAATGTAGTAGTCGCTTGTCAAAATCGCATTGTTTTTCGCAATATATTCGCGTTTTCAGACTCAACAGTCGCACTTTGTTGGACACATTCATCGCCTCATCGATGGAGCACCTTTGTGGCTAACAGAGTGACGAAGATACAAAGCTATTTATCTCCACAAAATCTATATCACGTGTCTGGTAAAGACAATCCCGCTGATTGTTTGTCGCGTGGCCTCACTCCTTCCCAAATAATTAATCACCCGCTTTGGTTTAGTGGCCCCCCTTGGGCACATTTGGATGTCGCGCAGTGGCCTGCTGTTCCTTTTAATCCTTCCGTAGAGCCTGAGGCGCCGGAAGAAAAGAAACAGACTTTTCTCGCCGCTACTTTAAATGAAAAATCTCCTATATTATCACTAGGAGATCGTATCTCATCTTGGTCTAAACTATTGCGCAGTGTAGTTTTCGTTTGTCGATTTGTAAAATTGTTACCTCACAGATATCGCATGTCAGCATCGGATTATGAGTTCGCTGAGTTATTAATTCTTCGTGAACTTCAACGGTTTTATTTTCGCGCTGAGATCGCGAAGCTCAAGGAAGGTCAAGTATGTAGCCCTGCATTTCGACACTTAAAACCATTTCTTAAAGATGGAGTATTTAGAGTAGGGGGACGTTTAAGAAACTCTGACTTGAGCTACGACGAGAAATATCCCATTTTGCTTCCGAGAAAAGATCCGATCTTGAATTTACTTGTCGAATATCATCATAAATTAAATTGTCACGCCGGTCCTGACCTGCTGATGGCGCTCTTACGTCAGAGGTATTGGATACTTTCTGCTCGTAATTTAATTAGGAATAGGATACACAAATGCATGCCTTGCTTTCGACTTCGTCCTAAGCCAACATTCCCTGAAATGCCGGATCATCGTTCTTGTCGTGTCGTTCAATCCGCTAAACCCTTCATTCACACGGGTACAGATTATGCTGGCCCTTTCAAGGTTACCATAACACGTGGGCGAGGTATTCGTTCTACCAAAGCTTACGTGTGTTTATTTGTTTGCATGACTACGCGCGCAGTACATATAGAACTGGCTGGTGATTTAAGCACAGCTAGTTTCATGGGAGCCTTCAAACGGTTCCTATCTAGACGAGGCCCGGTGGGTAGAATTTATTCGGACAATGGAACGAATTATATAGGTGCTAAACGCAAGCTTTCAGAACTTCATGAATTTCTTTGTTCAAAGTATCATAATACAGAGTTTGGTCACGTCTTAGCTGAAAATCGCATTGATTGGTCCCTAAATGTACCGACAGCTAGCCATTTTGGCGGAAATTGGGAGGCTAATATCAAAAGCTTAAAGTCTCATCTATATCGCGTTATAGGTGATACAATTCTTTCATTTTGA
Protein
MESLVVDKITERLPTTTVDASLLSNFEDIALADDTYFNPGPIQLLIGASIFPHLLLSNKVQGRPSHASPIALETILGYVIVGDAPVRVASNESVSYCCTGDPLDSTIRKFWELEEVDVPFVFSPEDKMSEEFYTSTTTRDSDGRYVVALPFKGDVNTLGKSRQASENRFYCLERKMQASPQLKLAYDNIILEYLEKNYLSAVDCDSSDISYFIPHHGVIRQDKVTTKLRVVLDGSCKTTTNVSLNDLLYRGQNFQGNLFNIIINFRLFPVALSADIRQMFLSIGVRESDRRFQRILYRFSPQQPLQVYEFNRVVFGLKSSPFHALRTIKQLAADEGVAYPRAREIIDTSLYMDDFVCSIPTEDIGISTASDMIGLMKAGQFELVKWMSNSQVVLDSIPPSHRLPGVKEFDESNQHKVLGLCWSPTSDNFCIKIDTPIEICTKRTILSCVAKIWDVMGFVAPVVLFVKLIIKQLWLSNCDWDDTPSEDIVKMWSRFKEELPLLSRIKIPRHVGMNVDSIATILGFADASEKAYGGVIYFHVQNNNDNTIRLITAKSKVSPKKVVSLARLELCAILILAQLIKNVVVACQNRIVFRNIFAFSDSTVALCWTHSSPHRWSTFVANRVTKIQSYLSPQNLYHVSGKDNPADCLSRGLTPSQIINHPLWFSGPPWAHLDVAQWPAVPFNPSVEPEAPEEKKQTFLAATLNEKSPILSLGDRISSWSKLLRSVVFVCRFVKLLPHRYRMSASDYEFAELLILRELQRFYFRAEIAKLKEGQVCSPAFRHLKPFLKDGVFRVGGRLRNSDLSYDEKYPILLPRKDPILNLLVEYHHKLNCHAGPDLLMALLRQRYWILSARNLIRNRIHKCMPCFRLRPKPTFPEMPDHRSCRVVQSAKPFIHTGTDYAGPFKVTITRGRGIRSTKAYVCLFVCMTTRAVHIELAGDLSTASFMGAFKRFLSRRGPVGRIYSDNGTNYIGAKRKLSELHEFLCSKYHNTEFGHVLAENRIDWSLNVPTASHFGGNWEANIKSLKSHLYRVIGDTILSF

Summary

EMBL
GEZM01054789    JAV73399.1    GBBI01004276    JAC14436.1    GAIX01013989    JAA78571.1    + More
GALX01004947    JAB63519.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    ABLF02030698    ABLF02030705    ABLF02030709    ABLF02030854    ABLF02067347    GBHO01044643    JAF98960.1    ABLF02008594    GDHC01006469    JAQ12160.1    GGMR01002421    MBY15040.1    GEZM01085145    GEZM01085143    JAV60187.1    GGMS01010524    MBY79727.1    ABLF02041863    ABLF02006304    ABLF02036268    GGMR01017890    MBY30509.1    KK114194    KFM61875.1    GEZM01054765    JAV73413.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    ABLF02035780    ABLF02036131    ABLF02041527    ABLF02064049    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    GEBQ01000825    JAT39152.1    GEBQ01015458    JAT24519.1    LNIX01000007    OXA51795.1    LNIX01000016    OXA46198.1    GFTR01008866    JAW07560.1    LNIX01000069    OXA36894.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    LBMM01009202    KMQ88311.1    LBMM01009551    KMQ88039.1    JXUM01030959    KQ560903    KXJ80414.1    GEZM01060254    JAV71154.1    ABLF02005684    GGMR01018506    MBY31125.1    GBHO01044645    JAF98958.1    GBHO01006408    JAG37196.1    GBHO01009080    JAG34524.1    EF426679    ABP48078.1    GBRD01007977    JAG57844.1    LBMM01009888    KMQ87813.1    GGMR01013370    MBY25989.1    GALX01000776    JAB67690.1    LNIX01000002    OXA59522.1    GGMR01000737    MBY13356.1    GGMR01014165    MBY26784.1    GBHO01023090    JAG20514.1    ABLF02042806    LNIX01000011    OXA48427.1    QOIP01000003    RLU24775.1    ABLF02008636    ABLF02065931    GGMR01010750    MBY23369.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GEBQ01028569    JAT11408.1    GDHC01014057    JAQ04572.1    ABLF02039606    LBMM01009964    KMQ87756.1    GBHO01044316    JAF99287.1    GBBI01004211    JAC14501.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    CR954257    CAJ14165.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    LBMM01011283    KMQ86917.1    LBMM01011245    KMQ86943.1    ABLF02025193    GGMR01018294    MBY30913.1    GAMC01020552    JAB86003.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    OXA60848.1    GFTR01008874    JAW07552.1    GDHC01016727    JAQ01902.1    LBMM01009688    KMQ87939.1    LBMM01010405    KMQ87487.1    LBMM01012188    KMQ86362.1    GBBI01004408    JAC14304.1    GBBI01004410    JAC14302.1    JXUM01113346    KQ565681    KXJ70776.1    GBHO01007061    JAG36543.1    LBMM01011244    KMQ86944.1    ABLF02025958    LBMM01009898    KMQ87805.1    LBMM01009746    KMQ87900.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1   
Pfam
PF00665   rve        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF03564   DUF1759
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR008042   Retrotrans_Pao        + More
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR005312   DUF1759       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR000727   T_SNARE_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
1041
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.43242
Exp number, first 60 AAs:
0.08186
Total prob of N-in:
0.00635
outside
1  -  1041
 
 

Population Genetic Test Statistics

Pi
319.855448
Theta
222.730816
Tajima's D
2.366144
CLR
29.298543
CSRT
0.931453427328634
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号