SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09862
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC105841899?_partial_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.568
 

Sequence

CDS
ATGTCGAGGGGGAACTCACCCCCAAATACCAGCACACCCGGCCCGTCTCATAGGGGACGTCAGGCGATGCCCGATTTACGTACCAGACCGATACCTGCTATCCGTATGGCCCCGATGGGTCCTCGGTTGGACAATTCGTCCGGGTCTTCGGCTGCGGCCGAGGGGGCCCCGAGGATCGGTCCGGTGGAAAGTATCTTTCCTCCGTCGACCGATCCCTCTGGGGCCTCTCGGCCGCGGAAGAAGGCCAGATCTGCTTCCCCCTCTGGGAGTCCAATCCCAGATCAACCCGTACCCAAGCCTAGGGCTCCCGCCAGGACAGGGACTGCTCCTAGGCAATTAAGAACCCCTCCTCATTCTCCTTCCCCAATCTTGTCCCCAATCCCGGTGGACTCTACCCGAGGTGCCCCCGCCCTAAGCGGCACGGCGGGTAACCTGGACTCTACCAGGTATATGGACCTAGAGTCCACCAGACCACATCACGCCCCTAAGCCTAACCCCATTCCCTCTACCTCCTATGCTGCCATGGCAGCTAGGCCGAGTATTCCTTCCACCCAGAGGACATCCCAATCCTCTCATGTCCCTCCCCCGAGGCCGAAGGGTCGTGCCCAAGAGGAGCTGCGCCGACATCCGCCAATAATGGTGGAGGCCCTCCCTAATTGGTCCCGCCACATGGCGGCCATTAGGGAGCGCCTCGGTCGCGCCCCCTCGGTGCGACCCTTCGGCGCCGGCTTTAGATTCCTGCCGACGTCGGTAGAGGAATACAGGGCGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGATGGTACCATAAAATGGTACTGCTATGCCCTGACAGGGGAGATTCCGACTAAGGTGGCTGTCCGGGGCCTCCCTGCCGATACTGACGCGGCAGAAGTAACCGATGCCCTGAAGGAGCTGGGGTTTCCGGCTCGTCACGCTAGGTGCATCAGGTCCCAGAGAGGGCGCCCGGGCTGCGTGTTTCACGTAGCCTTGGACCACCTCTCGAAGGACGACCTCGCCCGCCTGTACGCAGTCAATGAACTGCTGTACTTGCCGGGGGTGACGATTGAGGGATGGCGACCAACCCGCGGGCCTGCGCAGTGTCATCGCTGCCAGGCCTTCGGGCACGCCTCCAATAATTGTCACCGAGCGGTCCGCTGCGTTCGATGTGCCGGGGAGCATGTCGTAGCGGACTGCCCGAGGCCGAGGGACGGCCCATTCTCCTGCGCCAATTGCGGGAAAGATCACGCTGCCGTCGACAGGCGGTGCGCGGTCTACCGCAAGAGGGCCAGGATGATGGGAGTAACCGTCCCTCCTCCTGCGCCGTTGGTGCCTCGATCCGGGAACACAGCTCCTCCTTCTGTAGCTCCCATTCCGAAGGGGAAGGGGAAAGGGAAAGGGAAATCTTCCCAACCCCAACCCCCTCCCCCGTCCTTATCCATCCACCCTGCCGTGTCAGTGGAGGCCAATCCATCAGCGGCAACGCTGATGGCTGAAGCCAACGCTCCGCGGCGGGGTATGCCCATTCCTACCCCTCGTGGTCTAAACGCTGCAAGCAGACCGCCCCTCTCACAACGCAGCGCTCCAGCCCGTGCTGGAGTACAAACCCCCCAATTACCAGGTCCTAAAACAAATAAAAACAGGCTTAAAAAACAACAAAAAAAACTAAAGAAGAGAGCGCAACGGGACGCAGTAGCGAACGCTCCTACTGCATCGGCTCCCCCGTCAACAAATTTAGTAATGGAGGTTGATATAAACCCCCCCATCGACCCTTCGCAACCGGCTTCAATACCGGAAACGACCCCACTGCCTCAGGCCCAACCAGCCATCTCGGGCACATCTCAGCCCCCCCTCCCCCCCCGCCCTCAGCGCGAGCGCCGCAGCGGTCGACAGGCCTCCCAGCCTGCCGGCTTTGCTGCATGGCTGCTGGCGCTCTGGGAGAACTTGGCCGAGGTGATCTCCGGAGTGATCCGCGAGATCGCCTCGGGCGCTAGCCCTGTCGGGGCTATCCTGTCGGGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTAGACTCCCGGCCCATCTGAAGGCGATCATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGTTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTTCCGGGGCTACGCGTGGGAGGAACGGATTGAGGAGGCCCGTGAGGACCCCTCTTCTGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGCAATGCTGGAGCGGCAGTTCGTTCCGAATGACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGTGAACCTACTCTCCTCCCCGGTGCCTCCGTTGGGAGTTGATGCTTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGTGAGGACGGTATTCCCTCCCTCGCATTCTTCCACTTCCCTGAAACGGTCGTGTCATATATGACACGGCTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTACCGTCCGATCACCTTGCTGTCGCATGTGGGCAAGTTGTTCGAGAGGCTGCTGCTGAGAAGGGGAAGATCCTTCTTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCTCAGGGAAGCGTCCTGGCTCCATTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTCGAGGGTAACCTCCAAGCGTGGGAAGTAGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCATCCAACGTCCCCTCTGCGGCCATTCTGAGGATGCAGAGGCTTTTGGACTTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACTGCGGCTATCCTCTTCGGTCCGGTCCGCACAACAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCAGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAATAAGGCGTTGGCGGCCGCTCGCTGTGCGAGATTCCTCCTCCGGCCGGTGTTGGCCTCTAGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGAGGCCTGGTATCACCTCATCCCGCAGGGTATGCGGGCGAGGTTACAGGTCCAGCAAAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTGGATGTGGAGTCGCTCGAGGAGTTCATTCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCGGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGAAGCAGAGGACCCCGAGGGACCTGGGCGGGCCCCCCGGCGCGCACTCTGCGTGGCCGGGGGCTCCGTCTGTGGGGGAGTTTTGCTGGACTTCCACCGGGCGCGTCCGAGGGTACCTCCCGCTCCGCGGGGGGAGAATCCCTCCGTGCGGTCGAGTGATCGGCCGCACGCTGCCCCACCGTTTCTGGGGGGGGGAAAACACTGCCACGACGAAGGGGGCGACAACACGGGTCGCGTAAGGGACAGAGTCCCCACCGTGCTGCTGGAGAGGTGCGACAGCCTCATCTCACTACACTCGGCGCGAAGCTCCGTGAGGGGCGACGTGTCCAGTGGGAGGGAGACACCGGCGCTGTTTGCCGATTGTGTTCGGCAGCGGACTCGGCGGAAGCGGAAGTCGGCTCGACAGCCGGCGTCCTCCGCTCCGTCCGATTCCTCGGAGGGCGAGCCTGCCAGTGCCAAATATATGGCGTTGGCGGAAGGGCCGGCGACTGCTGCGGCGTCGCCCGCCACAGGATTTGATTTTGACAAGCCGTCGTCTTGCGGACTGGACGCTGCCTCCTCGGCGCAGTCCAGGGCCGCCTGCAGTGAGACAAAAAATAAAAAAAACAAAATCGGAGAGATCGAGCGCCTTCAGCGGTCCCTGACGTTGGTGGGTCCCTCTGACCCCCTCCGATCTTGTCAAATAGTCGGAGAAATAGTTACGACCATAGCGGCCAAATCAACTGCAGGCCTCAAGGGCTCCGAAGTGTCGGCAATGAAATCGGCGGCCGCCACACTAGAGGAAAGGTTGCAGGACGTCGTGGACCGCACCACAAACGCCGAGACGGCGGGCTTGCGGCAGGAAGTGGCCCTACTGCACGCCCGCCTTGAGCAAGTGTCGACTGAGAATGCGCATCTTCAGTCGGAGAATGGGCAACTTAAAGTGGACATGGCCGAGTTGCGAACGATGGTTGCCGACCTCATCGACCGGCAACGCAGCTCGGCCCCTGTCCCTCCTCCGCCCGAAGTGGAAGGCCTCAGCGAGGCCGAAGAGTTGAGGCGGCAGCTCCTTATACAGGAGGCGCGCAGCTCGAAGGTGGAGCGTGCGCGGCCGCCCCTCGCCCATGAGGCGAAAGGCAGTGCGCCTGTGCCAGCGCCCCGCAGGAGGGTGCAGCCCGCTGTAAAGACATACAGCGGGAAGAAAGCGACACCCGCGCGAGCTCCCACTGCGGCTGCACCTATACCCGCGGCTGCGGGGGTGCCGGCACCCACGGCCCCTGCAAGAAAACCGGCGTCCGCTCCTGCTCCGCCCCAGCCTGTGAAGGCAGGGCCCGGCAGGAGCCGGACAAAGAAGAAGGGAGGCGTCAACGCCGCCAAACCGGCACTGACCCCCCAGCCCCGCCCACTGCCCCCCGCCCCGGCCAACATGGATGAGGCCTGGACGACGGTAGTGCGGAGAGGGCCCAAAAAGGTAGCGGCGCCTGCCGCGCCGCGCCCCAAGCCCGCCCCTGCGGCCACCGCTCCCCGCCAACAGGGTCGAGCGGAGCCGAGGGGTCGAACTGGACGAAGAAGGCCGCGCGCCCCGCGGTCGGCTGCAGTGGTCGTAGAGCTGCTGCCGGCCGCAAAAGAAAAGGGCATCACCTATCACGAGGTGATGACCCGGGCGCGCGGTGGCGTGAATGTGGATGCCCTCGGCGTGGAGGGTGGCCTGAAGGTCCGGCAGACGGCCAACGGGGCCCGCCTGGTAGAGTGCCCCGGCCCGAACACCAACGCCGCGGCCGAAAAATTGGCGGCCCGGCTGAGGGAGATCCTGCCGGACCCCAAGGTGGTGCGCATCGCGCGGCCCGTAAAAATGGCGGAGGTGAAGATTACGGGCCTCGACGAGTGCGCCACGAAGGAGGAGGTCGCCGCGGCCATCGCGTCGCAGGGCAACTGCGCCCTCGCCGACGTCAAAGTCGGGGAGCTCCGGGCAACCTACTCCGGTACCCGGACGGCGTGGGCGCGTTGCCCCATCGCAACGGCGAACCTCCTGGCCACCCCTCCACAGGGTCGGCCTTCAGATAGCCCAGGATGGCTGCGCGTGGGCTGGGTTGTCGCCCACGTGCAACTGCAGGAGAGCAGGCCGTGGCGCTGTCTTCGGTGCTTCGGCACCGGCCACGGCCTCGCCAAGTGCCCCTCGACAGTGGACCGCAGCAACCTGTGCTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCCTCCTGCACCGCAGCCGCGCCGCACTGCGTCTTGTGCGACGCGGCTAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCGTGCAAGTCCACCCCCTCCTCTACAAAAACGAGGAGGGGCGGAAAGAAAAAGAAGCCGGCTGCAACAAGGGCAGCCGGCGAGTCAGTTCCCGCCGCGGCTGTTGTCGAGCCGCAGGGCGGGACAGACGAGGGAGCGATGGACGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGACGTCGCTGTCGCTGCGGAGCCGTACTTCGTCCCCACCGACCAGGACTGCTGGATGGGGGACGTCGACGGCTCCGTGGCCATTGTGTTGAGACAGTCCGCGGCGTTACCCCCCTTGGAAATGGTGGCCAGGGGACCCGGGTACGTCGCGGCTAGGATCGACGGGACCGTTGTGATCGGGGCGTACTTTTCTCCGAACAGGAGCCTCGCCGAGTTCGAGCGGTTTCTGGGCGGGCTCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGCAGACGGCGCTGCAGCTGGCCATCAGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAACCGTGGGCGCTCCCGGTGACCGAGCGTCTCCAGCCTCGGCAGCTGCGGGAAATTGTTGCGGCACTCTTCCCGCCGGCAGCGGGGGGGGACTTTGAGCCCCCCCAGATGGACGCCACGTGGGGCACGCCTCCACGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAAAATGAGAGCGAAGGACACGGCCCCTGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTCGAGAGGATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTTGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGGGCCCTCTCCGATGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTATCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCCCTCCCCGGGCTGAGCGTAATCTGTTACGCCGACGACACGTTGGTCGTGGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACTAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGATGTTTCACGGGCCGGGACGAGCGCCGCCTGTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAACTTCCGCGCTCACATTGAGAAGTTGGGCCCTCGGCTGATGGCAACGGCCGGCTCTTTGAGCCGGCTCCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTTGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACCGTCGAGGCGGTCCGTCCGGTCCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAGATGTTGACCGGCCATGGGTGTTTTGGCCGGTACCTCTTTAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MSRGNSPPNTSTPGPSHRGRQAMPDLRTRPIPAIRMAPMGPRLDNSSGSSAAAEGAPRIGPVESIFPPSTDPSGASRPRKKARSASPSGSPIPDQPVPKPRAPARTGTAPRQLRTPPHSPSPILSPIPVDSTRGAPALSGTAGNLDSTRYMDLESTRPHHAPKPNPIPSTSYAAMAARPSIPSTQRTSQSSHVPPPRPKGRAQEELRRHPPIMVEALPNWSRHMAAIRERLGRAPSVRPFGAGFRFLPTSVEEYRAVQAYLSEASARDGTIKWYCYALTGEIPTKVAVRGLPADTDAAEVTDALKELGFPARHARCIRSQRGRPGCVFHVALDHLSKDDLARLYAVNELLYLPGVTIEGWRPTRGPAQCHRCQAFGHASNNCHRAVRCVRCAGEHVVADCPRPRDGPFSCANCGKDHAAVDRRCAVYRKRARMMGVTVPPPAPLVPRSGNTAPPSVAPIPKGKGKGKGKSSQPQPPPPSLSIHPAVSVEANPSAATLMAEANAPRRGMPIPTPRGLNAASRPPLSQRSAPARAGVQTPQLPGPKTNKNRLKKQQKKLKKRAQRDAVANAPTASAPPSTNLVMEVDINPPIDPSQPASIPETTPLPQAQPAISGTSQPPLPPRPQRERRSGRQASQPAGFAAWLLALWENLAEVISGVIREIASGASPVGAILSGGAIDQATTLVPSGGPRGRLPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSFRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAAMLERQFVPNDSAPSEAAFHQSVEESVVNLLSSPVPPLGVDAFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSYMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPITLLSHVGKLFERLLLRRGRSFFVAVEGAKSSVRPVTAGVPQGSVLAPFLYALYTNDIPTLEGNLQAWEVDVKLALFADDSAYFSSSNVPSAAILRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTTVVPGQLSLRGANVEFRSSVQYLGVDIDRSLRMTAHANKALAAARCARFLLRPVLASRLPVRTKLGIYKTYVRSRITYAAEAWYHLIPQGMRARLQVQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGRALPRELLEPPAMEAEDPEGPGRAPRRALCVAGGSVCGGVLLDFHRARPRVPPAPRGENPSVRSSDRPHAAPPFLGGGKHCHDEGGDNTGRVRDRVPTVLLERCDSLISLHSARSSVRGDVSSGRETPALFADCVRQRTRRKRKSARQPASSAPSDSSEGEPASAKYMALAEGPATAAASPATGFDFDKPSSCGLDAASSAQSRAACSETKNKKNKIGEIERLQRSLTLVGPSDPLRSCQIVGEIVTTIAAKSTAGLKGSEVSAMKSAAATLEERLQDVVDRTTNAETAGLRQEVALLHARLEQVSTENAHLQSENGQLKVDMAELRTMVADLIDRQRSSAPVPPPPEVEGLSEAEELRRQLLIQEARSSKVERARPPLAHEAKGSAPVPAPRRRVQPAVKTYSGKKATPARAPTAAAPIPAAAGVPAPTAPARKPASAPAPPQPVKAGPGRSRTKKKGGVNAAKPALTPQPRPLPPAPANMDEAWTTVVRRGPKKVAAPAAPRPKPAPAATAPRQQGRAEPRGRTGRRRPRAPRSAAVVVELLPAAKEKGITYHEVMTRARGGVNVDALGVEGGLKVRQTANGARLVECPGPNTNAAAEKLAARLREILPDPKVVRIARPVKMAEVKITGLDECATKEEVAAAIASQGNCALADVKVGELRATYSGTRTAWARCPIATANLLATPPQGRPSDSPGWLRVGWVVAHVQLQESRPWRCLRCFGTGHGLAKCPSTVDRSNLCFRCGQPGHKAASCTAAAPHCVLCDAAKRKADHRAGGPACKSTPSSTKTRRGGKKKKPAATRAAGESVPAAAVVEPQGGTDEGAMDDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWMGDVDGSVAIVLRQSAALPPLEMVARGPGYVAARIDGTVVIGAYFSPNRSLAEFERFLGGLCCCVGAKTRAARGRGCGADGAAAGHQRGQEAEHEDSPGVARRRSLGRPYKMVRRKLQPWALPVTERLQPRQLREIVAALFPPAAGGDFEPPQMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSKMRAKDTAPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLLAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALMFHGPGRAPPVGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHIEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLFKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00417852,     Score=103

Ontologies

Topology

Length:
2876
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18134
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  2876
 
 

Population Genetic Test Statistics

Pi
360.614359
Theta
229.109924
Tajima's D
0.502302
CLR
158.343668
CSRT
0.51662416879156
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号