SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09861
Annotation
retrovirus-related_gag-pol_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 4.129
 

Sequence

CDS
ATGAATCGTAGTGCGCAAATTTTGAAAATGGTGTTCTCTGAAGACCAAGAGAATCCAGTTGTTTATAATAAGCCCATTTTCAGTCCTTTAGATACTGTTCGCAGTCTTGTAAAAAGCGATGTTAATAATATATCAAATTTAAATAGCCACAGTTATGTTTCGGATTCACAAATTGTGCCATATTTTATGAAGAATGATCTACCTGGACCAAATAATGTTGATATGGAACCTACAGTAAATTATTCAGAATCAGTATCAAGTAACCAAATACAACTTTCTGACCTTCAACGTCCACGATTGAATAAAGTAGTTCCAGAATCTAATTGTTCTTCAGAATACAATGATGATAATTCTAAATCTGAATATTCTAATAGTCAAAATGACTTTTCATCTGATGATGTCGATAATGACCCCGATTTTTTATATAAAGATCTTGAATTATCTTCTACATCTGAAGATGAAAGCATCACAATGAGTAATCGGCGAGAAAAAATAATTGAAATTGAACAAGAAAAGAAAAAAGGAAGAAAACGGAGAGCTGTACCCAAAGAATGGAAAAAAAATAAAGCAAAACTATTAAGGAACTCTGGAAAAGCGTATTTATCGTCATCTAAATCAAAAAAGCTAATGAAAGAAAGGGAATTAAAACCAACTTGTAATGATAAGTGTAAACTGAAATGTTTTAATAAGATAAGCGAGGAAAAGCGTCAAATTATTTTTTCGAACTACTGGAAGATGGCAGACTTAGAAAAACAACGTCAGTTCATTAATAAATATGTAAAAGCAATTAAACCTAAATATCGCTATATTCGTGAAGGAAGTACTAGAAAAGATTATAATCACGCATTTTATTTTGAAGTAGACAAAGAAGATATCCGGGTTTGCAAAACATTTTTCAAAAATACATTAGGCATATCAGAGAGACCAATAAGAACGGTGATTTATATGCAAAACTCTGTAGTTGGAGGTTTTCTAGCAGGTGATAACCGAGGGAGACATGGAAACCACAATAAACTTGACAGCACAGTTATTGAAAGGATTAAAGAACACATCAATTCCATTCCTAGAATCGAGAGTCATTACTGTCGGGCTACTACAAGTCGAGAATATATTGAAGGAGGGCTTTCCATTGCGCAATTGCATAGAGACTATGTTGAAAAATGCCGAGCAGAAAGTCGATCGTATGCTGACTATCAAATATATTATAATATATTTAGCAAAGAATATAATATTTCGTTCTGGTCTCCAAAAAAGGACCAATGTGAAGATTGTGCAGCTTATGATAATGCAGAAGATAAACAGCCATTAGAGGACAAGTATTTTTCTCACCTAGAAGAAAAAGACTTAGTCAGGAAAGAAAAAGAACTGGATAAAAAAAATACAAATAATAAATGTATAGCTGCCACCTACGATTTGCAAGCCGTAATGCCATGTCCTAGAGGTGACATCTCCAATTTCTATTACATTTCTAAACTGAACGTACTCAACTTTACCATTTACGAGCTTGGCTCCAAAGATGTGAATTGCTACGTCTGGCACGAAGGTGAGGGATTAAGAGGGAAGATTCACATGCGAGCTATTCTGAAGAAGAATGATTTGTGGGAATACGTATCAGGAAAAATACCGAAACCAATACATTCAGATTCTAAATATTCTGAATGGAATAAAATGGACGGAAAAGCCGAATCGGACATATTGTTAGCTGTCAGCCCGAGCGAGTTAATTGCACTGGATGGTTTAGACTCCTCTAAAGCAATATGGAACAAGTTAAAATCTATGTATGAGTCAAGCGGGCCAGCGCGAAAAGCGTCATTACTAAAGAGACTTGTATTAAATCATATGCCAGAAGATGGAGACCTACGAAAATATATTTCTGATTTTTTCGACTGTGTTAAGAAGCTTAAAGAAATCGGATTGATAGTGATAGATGAGTTGCTTGTTATTTTATTACTTTATAGTTTACCGGATTCGTTCTCAATGTTTCGAACAGCAATGGAATCGCGTGATGATTTACCATCAACTGATGTACTGAAAGTGAAGATTATCGAGGATTATGAAGGTCGGAAGAATAAGATAATAGACCAGAGGGCTATGTTCGTCAAGCGTACCAATATTAAATCAAATGCCAACCCGAAGAAGAACTTCGAACAGCACACAAATAAAAACATTGAGTGCTATCGTTGCGGTCGTCTTGGGCATATGGCGAGAGAATGCAGAACTAAAAACGTGAGTAAGCTTAAACAAAGCTCACATAAAGCAGAATGTAATAGTGATGATGAGCTCAAGACAAATATGTTAGTAAGTACCACCAAGGAGGTGATGATAGCCGAGCAGAGAGCTCCTGTATGGTGTATTGACAGTGGATGTACGGGACATATGTGTAACAACAAACAATTGATTAAAGATTTTACTCGAGTTGATACAGACTTGAATTTGGCTAATGGTAAAACTACAAAAATTAGCGGTTCGGGAAAAGTCAGTATTATGGTAGACATAGGCAGCGAAAAGCACCATGTTGATATTAAAAAAGTGTTCTACGTGTCGGATCTACGAACCAATTTATTATCAGTTGCGAAGATGACAGATCACGGGTTTGAAGTTCGCTTCAATAAAAATTATGCAATTGTCATAGATGACAATAATAAGGTTCATATGCGAGCGGATCGAGTTGGTAACTTATACCACGTCCGAATGAGCCAAGATGATGTCAATAATGTTGAAATGGTGAAAAAACCTATAGATATGTGGCACGAGCGCCTCGGCCACCTTAACGAGCGTGATTTGAAGGCAATGGCAAAAAATGGCCTTGTCCATGGCCTATCATTGAAGGACAACGAAAAATTGTCAGAGTGTGAAATATGTATAAGTGAAAAACAGACATGCACGTCTTTTTCTAAAGGAAGCGAAGATCGTACAAGTGAACTATTGGAGATCGTGCATACTGATGTGTGCGGACCAATGAGACAACAGTCTATGGGCGGTAAAAAGTATTTTGTCACGTTCATCGACGACAAATCAAGATGGTGTGAAGTATACTTTATTGCTAATAAAAGCGACGTACTTCAAGTTTTCAAAGATTACAAGGCTTACGTGGAAAAATTGACAGGAAAGAAGATCAAAAATCTACAATCCGATAACGGTCGAGAATACATTAACAAAGACTTTGATGATTTCTTGAAGAAAGAAAGAATAAGACGGAGGTTGACGGCACCTTATACGCCTCAGCAGAACGGGATTTTGGAGAGAAAGAACAGGACACTGCTGGAGATGGCCCGTTGTATGATGCGTCAGGCGGGAAGCCCTCCTGTTTTTTGGGCTGAAGCAATTAATACTGCTAATTACATAAAGAACCGGTGCCCAACTGCAGCTCTTGATGGTCAAATACCATTTACCCTGTGGACAGGAAAGAAACCTACCGTAATCTACATGCGCGTGTTTGGATCGAAAGCGTATTATAAAAACAAAGGAACGCAGAAGGGAAAATTCGAATCAAGTTCAGAGCTTGGAATATTTATGGGCTATGATACTGAGTCTAAAGCTTACAGAATACATGATCCTAAGACTAGAAGGATCGTCATTTCTCGCGATGTGAAGTTTATGAACGAGACAGCATTCTGTCATGAGTATAAAGAAATACGAAACGATGAAGAACAGAATTTTGATAATTCGAAGATAGTCGTTGAATTGACAGGACATGATCAGAAGAAGGAAGATCGAAAAACAAACCCCATGAGAGGGAGAGGAAGACCAAGGATAGTTCGTACTGGCTTAGTGGGAAGACCGCGCAAAGAGTATAAACCAGCTACTATCAGTACAGAGAGTGAAACTGAATCGGAGTATGAAGTAGATAATGAAGAAACGACAGCTGGAATTGCGATCATTGAACCTAAAACATGGAAAGAAATAGAAAAGACTGATGACGAACCTGAATGGCGAAGGGCTTTAGAAGACGAGTATTTGGCACAATTAAAGAATGTTACATGGGAAATAGTCCCACGACCAAAAAATAGAAAAGTGATTGGTAGCAGATTTGTATTTCAAACAAAGAATACAGGGAAGAAAGTACGGCTTGTCGCAAAGGGATGTTCTCAAAGGCCAGGGGAGGATTTTTACGAAACCTCTTCTCCTGCTGTAAGGTCTTCATCTGTGAGACTCATAGCTGCAGTGTCAGCTGAGTTAGGATTAGAGATGCATCAAATGGATATAGTAACAGCTTACTTGAATGGTACTCTCGAAGAAGATGTATTCATGGAAATACCAGATAAACTATCAGATGTCTTAGAAAGTGTACTAGCAAACCAAAATATTGGATCAAAAAGAAATATTATAAAAGATAAGAATATACTTCATACAGCTAAACGCTGGAACGAAGCATTGAATGAGTGTGAGAATAATGTGTGTTTGTTAAAGAAGTCTTTGTATGGTTTGCGTCAATCAGGATTACAGTGGCATAAAAAGTTAGTAGGAAGGTTGAAGAATATTGGTTTTGAAGCATTACCACAAGAACCTTGTGTGTTTGTTGCGCAAAGGGATGAAAAAATGATGTTAATTGCTATTTATGTAGATGACATTATCCTAGCTACTAATGATGAGGTGTGGTTGCATGATGTTAAGCGTCAGTTATCTAATGCCTTTGAAATGAAGGATATGGGAAAAATCAGTACTTGTTTGGGTATCGAATTTTCACGTGATAAGGAGCATAGAGTGTATTTAAAGCAAGGTGCGTATATAGATAAAATATTAGAGCGTTATGGTATGAGTGATTGTAAACCTATATCAACACCTATGGATGTGAACGTTAAACTAGAAAAACCCAACAGTGTAAACAATGATGTTATGAGTCAGTACCCTTACCCTTATAGGTGCCCTTATCATTGGAAGGCAGCTAAGCGAGTGTTGAGGTATTTGAAAGGTACATCAACTTTCGGCTTAATGTATGAGAGGACAGGTGTACCATTGTTTGGTGTAGTTGATGCAGACTGGGGTGCAAACACGATTGATCGAAGGTCATATTCCGGTTTTGCATTTATTTTAGCAGGTGCCCCAATTACCTGGGAAGCACGAAAACAGCGTACCGTTGCATTATCGAGCACAGAAGCCGAGTACTTGGCGCTTTCTGAAGCAACTAAGGAAGCTATGTATCTCAGAAATGTGGTAAATAATATTGGTGTAAAATGTGGTTGTGTGACATTATTTAATGACAACCAGGGTGCTATGAAGCTTACACAGAATAGAAGCTATCATTCTCGCACTAAGCATATTGATGTTAGACACCATTTTGTTCGAGATATGTGTGAACAGAGTGTGATTGATTTGAAATACTTGAGTACAGACAAAATGCCTGCTGATATTTTGACCAAGGGCTTGTGTGGGATGAAGCATTATGAATGCATGAACAATTTAGGAATGATGGAATAA
Protein
MNRSAQILKMVFSEDQENPVVYNKPIFSPLDTVRSLVKSDVNNISNLNSHSYVSDSQIVPYFMKNDLPGPNNVDMEPTVNYSESVSSNQIQLSDLQRPRLNKVVPESNCSSEYNDDNSKSEYSNSQNDFSSDDVDNDPDFLYKDLELSSTSEDESITMSNRREKIIEIEQEKKKGRKRRAVPKEWKKNKAKLLRNSGKAYLSSSKSKKLMKERELKPTCNDKCKLKCFNKISEEKRQIIFSNYWKMADLEKQRQFINKYVKAIKPKYRYIREGSTRKDYNHAFYFEVDKEDIRVCKTFFKNTLGISERPIRTVIYMQNSVVGGFLAGDNRGRHGNHNKLDSTVIERIKEHINSIPRIESHYCRATTSREYIEGGLSIAQLHRDYVEKCRAESRSYADYQIYYNIFSKEYNISFWSPKKDQCEDCAAYDNAEDKQPLEDKYFSHLEEKDLVRKEKELDKKNTNNKCIAATYDLQAVMPCPRGDISNFYYISKLNVLNFTIYELGSKDVNCYVWHEGEGLRGKIHMRAILKKNDLWEYVSGKIPKPIHSDSKYSEWNKMDGKAESDILLAVSPSELIALDGLDSSKAIWNKLKSMYESSGPARKASLLKRLVLNHMPEDGDLRKYISDFFDCVKKLKEIGLIVIDELLVILLLYSLPDSFSMFRTAMESRDDLPSTDVLKVKIIEDYEGRKNKIIDQRAMFVKRTNIKSNANPKKNFEQHTNKNIECYRCGRLGHMARECRTKNVSKLKQSSHKAECNSDDELKTNMLVSTTKEVMIAEQRAPVWCIDSGCTGHMCNNKQLIKDFTRVDTDLNLANGKTTKISGSGKVSIMVDIGSEKHHVDIKKVFYVSDLRTNLLSVAKMTDHGFEVRFNKNYAIVIDDNNKVHMRADRVGNLYHVRMSQDDVNNVEMVKKPIDMWHERLGHLNERDLKAMAKNGLVHGLSLKDNEKLSECEICISEKQTCTSFSKGSEDRTSELLEIVHTDVCGPMRQQSMGGKKYFVTFIDDKSRWCEVYFIANKSDVLQVFKDYKAYVEKLTGKKIKNLQSDNGREYINKDFDDFLKKERIRRRLTAPYTPQQNGILERKNRTLLEMARCMMRQAGSPPVFWAEAINTANYIKNRCPTAALDGQIPFTLWTGKKPTVIYMRVFGSKAYYKNKGTQKGKFESSSELGIFMGYDTESKAYRIHDPKTRRIVISRDVKFMNETAFCHEYKEIRNDEEQNFDNSKIVVELTGHDQKKEDRKTNPMRGRGRPRIVRTGLVGRPRKEYKPATISTESETESEYEVDNEETTAGIAIIEPKTWKEIEKTDDEPEWRRALEDEYLAQLKNVTWEIVPRPKNRKVIGSRFVFQTKNTGKKVRLVAKGCSQRPGEDFYETSSPAVRSSSVRLIAAVSAELGLEMHQMDIVTAYLNGTLEEDVFMEIPDKLSDVLESVLANQNIGSKRNIIKDKNILHTAKRWNEALNECENNVCLLKKSLYGLRQSGLQWHKKLVGRLKNIGFEALPQEPCVFVAQRDEKMMLIAIYVDDIILATNDEVWLHDVKRQLSNAFEMKDMGKISTCLGIEFSRDKEHRVYLKQGAYIDKILERYGMSDCKPISTPMDVNVKLEKPNSVNNDVMSQYPYPYRCPYHWKAAKRVLRYLKGTSTFGLMYERTGVPLFGVVDADWGANTIDRRSYSGFAFILAGAPITWEARKQRTVALSSTEAEYLALSEATKEAMYLRNVVNNIGVKCGCVTLFNDNQGAMKLTQNRSYHSRTKHIDVRHHFVRDMCEQSVIDLKYLSTDKMPADILTKGLCGMKHYECMNNLGMME

Summary

EMBL
LBMM01008999    LBMM01007721    KMQ88472.1    KMQ89488.1    GFTR01008771    JAW07655.1    + More
JYDP01000350    KRZ01021.1    JYDN01000113    KRX56900.1    JYDM01000185    KRZ84108.1    JYDJ01000518    KRX34768.1    LBMM01012368    KMQ86259.1    LBMM01007580    KMQ89607.1    LBMM01008805    KMQ88628.1    LBMM01008884    KMQ88558.1    GAMC01013937    JAB92618.1    GBGD01000131    JAC88758.1    GAMC01015163    JAB91392.1    FJ238509    ACI62137.1    GAMC01008929    JAB97626.1    GBXI01002679    JAD11613.1    GAMC01008189    JAB98366.1    GBXI01007143    JAD07149.1    GDHF01006360    JAI45954.1    GBXI01017107    JAC97184.1    GAMC01020355    JAB86200.1    KQ460297    KPJ16236.1    GAMC01018338    JAB88217.1    GDHF01030254    JAI22060.1    GAMC01019998    JAB86557.1    KQ459875    KPJ19636.1    FJ544853    ACL97384.1    FJ544856    ACL97386.1    FJ544851    ACL97383.1    FJ544854    ACL97385.1    KQ484038    KYP38095.1    OIVN01000557    SPC82046.1    JYDL01000068    KRX18751.1    OIVN01002854    SPD06945.1    OIVN01001534    SPC95017.1    JXUM01155348    KQ572178    KXJ68066.1    KA648745    AFP63374.1    CM007899    OTG12557.1    OIVN01005591    SPD23209.1    AC134048    DP000010    AAX92941.1    ABA91548.1    OIVN01001666    SPC96375.1    OIVN01004379    SPD17029.1    OIVN01002247    SPD01987.1    CM007900    OTG08534.1    KQ483456    KYP50361.1    CM007892    OTG31811.1    OIVN01000036    SPC73022.1    QGNW01000255    RVW81243.1    QGNW01000381    RVW73873.1    QGNW01002195    RVW23445.1    QGNW01000029    RVX11927.1    OIVN01004879    SPD19723.1    QGNW01001602    RVW35576.1    QGNW01000267    RVW80348.1    QGNW01001457    RVW40577.1    QGNW01000493    RVW69546.1    QGNW01002058    RVW25839.1    AM433482    CAN69340.1    AC129717    AAT85194.1    OIVN01002424    OIVN01005946    SPD03496.1    SPD24589.1    RVW80345.1    QGNW01000769    RVW62538.1    AAZX01023229    OIVN01001931    SPC99063.1    CM003610    KYP61490.1    QGNW01001343    RVW44710.1    QGNW01002193    RVW23526.1    AM447500    CAN74198.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF14244   Retrotran_gag_3
PF13976   gag_pre-integrs
PF13961   DUF4219
PF00098   zf-CCHC
PF13855   LRR_8
PF03106   WRKY
PF03159   XRN_N
PF17846   XRN_M
Interpro
IPR029472   Copia-like_N        + More
IPR025724   GAG-pre-integrase_dom       
IPR036397   RNaseH_sf       
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR025314   DUF4219       
IPR036875   Znf_CCHC_sf       
IPR032675   LRR_dom_sf       
IPR036576   WRKY_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003657   WRKY_dom       
IPR004859   Put_53exo       
IPR041412   Xrn1_helical       
IPR027073   5_3_exoribonuclease       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF118290   SSF118290       
Gene 3D

Ontologies

Topology

Subcellular location
Nucleus  
Length:
1805
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03178
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00092
outside
1  -  1805
 
 

Population Genetic Test Statistics

Pi
184.689013
Theta
198.468905
Tajima's D
0
CLR
1144.325223
CSRT
0.365931703414829
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号