SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09860
Pre Gene Modal
BGIBMGA013155
Annotation
PREDICTED:_fatty_acid_synthase-like_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.088
 

Sequence

CDS
ATGATGTACCCTATAGGCGGAATATTAATGCTGGTATGGGATACACTTTCTATGTCAATGTCTTTGCCTAAGAGGAAAATATCGGTTAGATTTCTCGATTTATTTATCGATGTTCAACCAGCACTTTACGAAGAAAAAATATTAAAATTGCGCGTCGCGATCAATAAGGGCGATGGACAATTTGAGGTTACAAATGATGGATCCAAAGTTGCAAGTGGAATTGTTTTACTGGTTAGCAAAAATATATTCGGAAAAGAAACTCATACAACTGACACTCCAATGACCTTGAACACGAATGACTTCTATCAACTACTACAAGAAAAAGGATACTCTTACAGCGAAGATTTCCGTCTGATAAAGAGTGTTAACTTGTCTTTATCAGAAGCCATGATAGAATGGCGCGATAACTGGGTGACGTTGATTGAGAATATGCTGCAGCTTGTTATCCTGAATCAGAACTATGATGGTGTTTTACAACCAACTCAGATTAATAGAATTGTTATCGATACCATTGAATCTTCAAATCAAACTTTTACAAAGCATGGAAAATGCGTATATATTAAGGATATTCAATTCCGTGAAACTTCTCGAACTCCATATCCCATTAGTCTGTTAGTTCCGTCGAGTGAAGAAAAAGGAAAATTGATTAACTTCAAAAGTGTGACTAGCTCATACACAAATGCGATGCTCCAAAGCGCGGAAACTGGGAACGTTAATTCCTTGCACTGGGCTGAAGTTTCTGAACCAAGTGGATCTGGAGTACTTGTTAAGGTACATTACGCAAGTCTTTCAAATTACGACGGTAAGAAGGCCTCAGGAACAGTACCGCATCGAGCCAGCGAGAACTATTATGGAATAGACTTCAGTGGGATAGCCGAAAGCGGAAGTCGTGTGATGGGTATAGTTCATCGTGGTGCTTGTCGAAATTATGTTCGAGCTCACCCCGATCTTTTGTGGCCAGTCCCTGATCACTGGAGCCTCGAAGACGCTGCCACAGTTCCTTTAGCTTACGCGTATGCTTTTTATTGTCTAGCAATCAAAGCTAAGCTGTGCGCCGGTATGAAAATACTTATACACGAAGGAGCTGGAGCACTCGGCCAGGCTGTCATTGCCATCGCTCTGGCACACAAATGCCAAGTATTCACTACAGTAGGGGATTTAAGAACGAAAAGGTTCTTGAAGAAACTATTCCCAGAATTGAAAGAGGAACATATTGGAAATTCTAGAGACATCACTTTCGGGGACATGGTTCTAACAGCGACAAATGGGAAAGGTTGCGATATTATAATAAGCAATGTCGAAACATCACTCAAAAACGTTTCACTTCAATGCGGTAATTATCAGAGCGTTATTTTTGATACGGAACAAATTGAGAAACGCGAGAATTTCGAATTGCGTATGAACAGTCTGATTAATGACAGATCCTATGTAACTACTAAGTTCGAGTCAATTTTTGAATTTTGGAATTCTGAAGAAATCAAAAATTTACAAATACTTATGAATGAAGGCATCTCCAGTGGCTACGTTCGTCCATTAGCTAGAGTGTCATACTCTTCAAAGGAAGCTCCTCGTGCTTTTCGACTCTTATGCAAGAATTGGCATCGAGGACATATATTATTGAGACTCACAGAACAAATGCTGCCAGCTCAACCAAGGATCAGCTGTAGATCCGAATGCAGTCAGTTAATCATCTGCAGCGAAGAAGATTTCGGTATTCAGTTAGCGAACAGACTTGTCAGTAGAGGTGCTACAAAAATACACATTTGTAGTCCGAAAGTCTCATGGTATCTCCAACATAAAACAGACAATTTAAAATCTATTGGTGTCAATGTGGTCGTATCTACGAACATAATAAAGGATTCTTACGATACTACATTTCTTTTAAAAAAAACTATAGCTATGGGACCATTAGAGGGCATTTATGTGGCAAACTTTAGAAATGACGACGAAACATTAAACATCCTGCAAGACATTGGTAATATGTCCAAAGATTTATTTCCATCATTAAGGTACTTTGCAGTGATTACCAACAATGTAAAAGTTCTAGAGAAAACGTGTATTTCTGGAGTAAACGATAATTCAATTATTTCTCTAATCGAAACTCGAAGGCCGCAAGTAAATGAGAATGAAAAAGACGCCATCTTATTAGACAAGGGAGCTTGGAACTTATCCACATTGAACGCTTTAGAGACCGGACTTCGCTGCAAGGTCCCATTGTTGGTCGCCCAAGGAAACACTTACACATCACCGCTGTATCAACAACTTGCAGCTTCTGCTGATATTCCATCTTTAGAAGATGCAAACGACGTCACTACTCTACGAGAATTGTCTGTTGGAAGCGAAAACATTAAAATAGTTAAAGAATTTCTACGTCAAAAATACCATAAGTGCTTTTTGGAACAGGAAATTTTGGAGTTAAACAAGCAGAAGCTTGAAGAGTTGGATTCTCTTCAAAACGGCTTCGAGAAGAAAGAAGGCTTAGCTGTTTACTTGTCTCACATAGCTAAAGATGAACTCAATTCCAATGCCCTCGTGTACTCTTTACCCACACTTGGCAATACGACAACGGAGAAACTGTCTGAAGCAATTGAGTCCGAGTACTTGTGCATAGTTCTTGGGATCGAGAATAATTTCGAAAGGTTTTATGGTATTTGCGAGAGACTTAAGCTGCCCGCGCTAGTGCTGCAGCCACGTCTGGATAGAACAAGCGATACTATACAGCAAACCGCCGAAAAATGCTCAAAGTTGATAACAGAGCAAATTGGTGTCAGAAAAAGTTTTTACTTGCTCGCATCCGATATCGGTATTTTAATTGCCATGGAGTTAGCTGCAATATTTGAGAGTAATGGTATTTTAGGCACAGTCTTCTGTCTCGGTAGTGCACCAGAAGATGTCAAGCCAATAATTGAACGTGAACTAGCCGCCTTCAAAACCGAAGACCAACTGCAGCTTGAGATTTTAAAGCACATTTTTAAGCTACTCACCGCTAATGATCCATCAATTTTAGAGAAAGCTTTGCCTCCTTTGTCCTCATGGAATGAAAAGATAGAGGGTTGCATTAAAATGATGACTGGTCATATAGCACAGACAAAGCAATATGTGAAAGCTTTGATACAATCTGTCTATGCGAAAATTCTTAGCATCAAGCAGTATGATTCTTCAACTCTGCCAATATTGAAGTCTCGAGTCATCATACTCCGCTCTCCGGATTGCTCCATTACTTCATCCCCATCATCATATTCTATTGAAGATTTATCAGCACCTCTTAGCGACGCTGCAACAGATACGCGATGTGCAGCCATTATCAACAAAAATCTGTCGAGTGAAATATTAGAAGAGTTTGATAAGAAAAACCTCTGCGACACATTTTTGATAAGCTTTGATGAGAAATATACAAAAGTTAATTCTAGAGTAATATGA
Protein
MMYPIGGILMLVWDTLSMSMSLPKRKISVRFLDLFIDVQPALYEEKILKLRVAINKGDGQFEVTNDGSKVASGIVLLVSKNIFGKETHTTDTPMTLNTNDFYQLLQEKGYSYSEDFRLIKSVNLSLSEAMIEWRDNWVTLIENMLQLVILNQNYDGVLQPTQINRIVIDTIESSNQTFTKHGKCVYIKDIQFRETSRTPYPISLLVPSSEEKGKLINFKSVTSSYTNAMLQSAETGNVNSLHWAEVSEPSGSGVLVKVHYASLSNYDGKKASGTVPHRASENYYGIDFSGIAESGSRVMGIVHRGACRNYVRAHPDLLWPVPDHWSLEDAATVPLAYAYAFYCLAIKAKLCAGMKILIHEGAGALGQAVIAIALAHKCQVFTTVGDLRTKRFLKKLFPELKEEHIGNSRDITFGDMVLTATNGKGCDIIISNVETSLKNVSLQCGNYQSVIFDTEQIEKRENFELRMNSLINDRSYVTTKFESIFEFWNSEEIKNLQILMNEGISSGYVRPLARVSYSSKEAPRAFRLLCKNWHRGHILLRLTEQMLPAQPRISCRSECSQLIICSEEDFGIQLANRLVSRGATKIHICSPKVSWYLQHKTDNLKSIGVNVVVSTNIIKDSYDTTFLLKKTIAMGPLEGIYVANFRNDDETLNILQDIGNMSKDLFPSLRYFAVITNNVKVLEKTCISGVNDNSIISLIETRRPQVNENEKDAILLDKGAWNLSTLNALETGLRCKVPLLVAQGNTYTSPLYQQLAASADIPSLEDANDVTTLRELSVGSENIKIVKEFLRQKYHKCFLEQEILELNKQKLEELDSLQNGFEKKEGLAVYLSHIAKDELNSNALVYSLPTLGNTTTEKLSEAIESEYLCIVLGIENNFERFYGICERLKLPALVLQPRLDRTSDTIQQTAEKCSKLITEQIGVRKSFYLLASDIGILIAMELAAIFESNGILGTVFCLGSAPEDVKPIIERELAAFKTEDQLQLEILKHIFKLLTANDPSILEKALPPLSSWNEKIEGCIKMMTGHIAQTKQYVKALIQSVYAKILSIKQYDSSTLPILKSRVIILRSPDCSITSSPSSYSIEDLSAPLSDAATDTRCAAIINKNLSSEILEEFDKKNLCDTFLISFDEKYTKVNSRVI

Summary

EMBL
NWSH01000156    PCG78965.1    RSAL01000223    RVE44002.1    KQ459602    KPI93194.1    + More
KQ461178    KPJ07769.1    PCG78967.1    RSAL01000008    RVE53970.1    PCG78963.1    RVE53971.1    JTDY01003263    KOB69848.1    AGBW02013713    OWR42929.1    U67866    AAB53257.1    JTDY01003650    KOB69211.1    RSAL01000068    RVE49259.1    ODYU01001294    SOQ37311.1    BABH01033637    ODYU01012325    SOQ58579.1    NWSH01000591    PCG75472.1    JTDY01005583    KOB66860.1    NWSH01003873    PCG65731.1    GEDC01024813    JAS12485.1    NNAY01001760    OXU23005.1    BABH01003987    BABH01003988    KQ434960    KZC12654.1    U67867    AAB53258.1    KZ288370    PBC26760.1    KQ435885    KOX69550.1    GL445739    EFN89136.1    GL449898    EFN81866.1    AGBW02007651    OWR55047.1    LBMM01000911    KMQ97230.1    KQ761246    OAD57941.1    GL438820    EFN68400.1    KQ971344    EFA05201.1    GECU01006695    JAT01012.1    GBYB01001820    JAG71587.1    KQ414663    KOC65238.1    KK107139    EZA57700.1    KQ976440    KYM86527.1    KQ459582    KPI99075.1    ODYU01009273    SOQ53573.1    ADTU01005072    ADTU01005073    ADTU01005074    ADTU01005075    NEVH01022635    PNF18738.1    EFA05204.2    ODYU01002245    SOQ39471.1    KQ982480    KYQ55999.1    GEZM01035401    JAV83262.1    ODYU01006431    SOQ48269.1    CVRI01000051    CRK99510.1    GL448189    EFN85168.1    DS235863    EEB19298.1    GL888175    EGI66082.1    PYGN01016841    PSN28987.1    KY797274    ATL76713.1    KB632169    ERL89446.1    AXCM01001692    KQ981954    KYN32228.1    KQ982519    KYQ55543.1    GALX01004174    JAB64292.1    KQ977574    KYN01849.1    KQ976413    KYM90403.1    MF817713    AXE71619.1    KA647365    AFP61994.1    APGK01049539    APGK01049540    KB741156    ENN73526.1    KQ977642    KYN01094.1    GL451785    EFN78551.1   
Pfam
PF02801   Ketoacyl-synt_C        + More
PF14765   PS-DH
PF00109   ketoacyl-synt
PF00698   Acyl_transf_1
PF16197   KAsynt_C_assoc
PF00975   Thioesterase
PF00107   ADH_zinc_N
PF08659   KR
PF00550   PP-binding
Interpro
IPR014030   Ketoacyl_synth_N        + More
IPR020843   PKS_ER       
IPR016039   Thiolase-like       
IPR020801   PKS_acyl_transferase       
IPR020841   PKS_Beta-ketoAc_synthase_dom       
IPR029058   AB_hydrolase       
IPR001227   Ac_transferase_dom_sf       
IPR020807   PKS_dehydratase       
IPR016036   Malonyl_transacylase_ACP-bd       
IPR016035   Acyl_Trfase/lysoPLipase       
IPR023102   Fatty_acid_synthase_dom_2       
IPR014031   Ketoacyl_synth_C       
IPR011032   GroES-like_sf       
IPR042104   PKS_dehydratase_sf       
IPR032821   KAsynt_C_assoc       
IPR036291   NAD(P)-bd_dom_sf       
IPR014043   Acyl_transferase       
IPR001031   Thioesterase       
IPR013149   ADH_C       
IPR018201   Ketoacyl_synth_AS       
IPR013968   PKS_KR       
IPR036736   ACP-like_sf       
IPR020806   PKS_PP-bd       
IPR009081   PP-bd_ACP       
IPR006162   Ppantetheine_attach_site       
SUPFAM
SSF50129   SSF50129        + More
SSF55048   SSF55048       
SSF53901   SSF53901       
SSF53474   SSF53474       
SSF52151   SSF52151       
SSF51735   SSF51735       
SSF47336   SSF47336       
PDB
6FN6     E-value=4.58226e-49,     Score=496

Ontologies

Topology

SignalP
Position:   1 - 19,         Likelihood:  0.637095
 
 
Length:
1139
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.39308
Exp number, first 60 AAs:
0.16587
Total prob of N-in:
0.00910
outside
1  -  1139
 
 

Population Genetic Test Statistics

Pi
285.795209
Theta
218.712061
Tajima's D
1.225083
CLR
0.016553
CSRT
0.716314184290785
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号