SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09858
Annotation
PREDICTED:_uncharacterized_protein_LOC106717302_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.674
 

Sequence

CDS
ATGGCTCAACTTTGTGAATCACAAAAAACGTTATCAGAACGTATTTCTAAGTTACAAAGTAATACTAAAAAGACGTCTAAATCAAGATACACACTTGGCTATCTACAAACACGCTTAGAAACATTAGAAAGTTATTGGTCTAAGTATCAAACTCAATATGAGATGATTAAGTCAACGGTTACTAAAACTGAATTGGAGCAATTACAATTTAATGTCGAAAGTCTATACGAGACAACTGAAGAGATATACCTAGAATTTAAGGGATTATTAAAGGATTATTTGTTGGAATTTTCGAAAGGTCAAGGTCAACCACAATCATATAATACTACGCAGAGTTTTTTAGCAACAAATGATGGTGAGACCACCCCGATTAGAACTAAATTACCTCCTTTATCGATTCCAAAGTTCGCCGGTAATTATAACGACTGGACAAGTTTTAAAGATTTGTTTAAGGCTCTCGTGCATGACAACGTGCATCTAACAACGATTGAAAAACATCATTATTTAAAAACGAGTTTATCGGGTGAGGCTGAACAACTTCTAAAACATTTTGCACTCACGGAGGCTAATTACGATAAGGCTTGGAGCACACTTGAGAGTAGATACAATAACAAACGTATGATTGTCACTACAATAATTAGCCGCCTTTTAAATCAAAAGAAGATGAACACAGAATGTTTTAAAAGCTTAAAGGAAATTTTAGATACTACGAAGGAATGTTTGAATTCTCTTGACAATATCGGCGTGGATACCTCCACATGGGATGCAATTATCGTTCATTTAGTTGTATCCAAATTGGACTTAAAAACACACAAACAATGGGAACAGTCACTTGGATCATCTCAAGACATACCCACATTTACCATTTTATCATTATTTTTAGAAAATCGTTTCCGTTCTATGGAGATGGTAAATGTTACCCACAAAAAAGACCAACCGCAGAAAAAAGACTTAACTAAAAATTATACAACCCAAAAACCCACAACTATGAAGTCATTTGTCACAGAAGTAAGCAGCAAATGCACTTATTGCTCACAAAACCATTATATTTGTTATTGTAAAGAATTCACCGCATTAGATGTTCCTCAACGTCAGGATTTTATTAAGAAGAATGGCATTTGTTTTAATTGCCTTGTAAAGGGTCACTCCGTTAATGCGTGTAGGCAGAGCACCACCTGTAGAAAATGTTGTCGACGACATCACACTCTGTTGCACTTCACAAACCCTAACAAGACCACAGCAGTGCCGGAAAGCGATGCAGCAACACCCAGTACACCTGAAACAAGCCAAACCACATCAACCGTCGTTTACAAGGCTGAGGTTGACAAAGACAGTGAGGAAGTATTATTGGCAACCGCACGAATTGCAGTTAAGTCGAGGAACGGCGACACGATAGTCTTGAGAGCACTGATTGATCCGTGCTCGCAATCAAACTTTGTTACTGAAGCGGCAGCTCAACTGCTTAATCTCGAGCGCACTTCAATCAGCGGAAATATTACTGGCATATCATCTATACCGCTGACCACCAAGTCACAAGTTACGTTGAACTTTCATGCTATAAGAAATTCTTCACACATGATCACAGCTAAGGCGTACGTCCTTAGACGAATAAATTCGAGATTACCATCACAAGAGCTCCCATCAGATACCTGGCCTTCTTCTGAGATTTCGGATCTTGCGGATCCACACTTCCACAAGCCAGGATCTATCGACGTGCTATTAGGTGCAGTTGTATATGCGCATATTATTCTTGACGGAATAATAAAACGCAATGAGTCTCTGGTCGCTTTGAACTCAAGATTGGGATGGCTGGTAAGCGGCGAAGTTGCGCAGTCTGGCCATCAGTCACACAATGTAGTTGTTATGCACACACAAGTCGAAGTTGATCAGTTGCTACGTCAATTTTGGGAGATTGATGAATATTCACCAAACATGAAGCCTCTGTCAAAACTTGAAATGCAGTGTGAAGAGCATTTTAAGAAAACTCACACTCGAAACACTGACGGTCGATATGAGGTTCGCCTACCCTTCAAGGACAAAGACGCTCCAAATTTAGGCAATTCCAGACAACTTGCTTTGAAAGGCTTACATCAGATGGAGAATAAGTTTAAGCGAAGACCCGAGTTTCACGAAGAATACAGCAAGTTCATGAGACAATATGAGTCACTCGGTCACATGGAGGTCGTCCCTGAAACAGAAAAGATGAATAGAGCTTATTACCTACCACATCATGCTGTTCTTATATTTGAACTGCCTATTGCTTTCGATTTTTGCGGCTATGTAAAGATAAGGCTCTCAAAAGGAACGATAACGTAA
Protein
MAQLCESQKTLSERISKLQSNTKKTSKSRYTLGYLQTRLETLESYWSKYQTQYEMIKSTVTKTELEQLQFNVESLYETTEEIYLEFKGLLKDYLLEFSKGQGQPQSYNTTQSFLATNDGETTPIRTKLPPLSIPKFAGNYNDWTSFKDLFKALVHDNVHLTTIEKHHYLKTSLSGEAEQLLKHFALTEANYDKAWSTLESRYNNKRMIVTTIISRLLNQKKMNTECFKSLKEILDTTKECLNSLDNIGVDTSTWDAIIVHLVVSKLDLKTHKQWEQSLGSSQDIPTFTILSLFLENRFRSMEMVNVTHKKDQPQKKDLTKNYTTQKPTTMKSFVTEVSSKCTYCSQNHYICYCKEFTALDVPQRQDFIKKNGICFNCLVKGHSVNACRQSTTCRKCCRRHHTLLHFTNPNKTTAVPESDAATPSTPETSQTTSTVVYKAEVDKDSEEVLLATARIAVKSRNGDTIVLRALIDPCSQSNFVTEAAAQLLNLERTSISGNITGISSIPLTTKSQVTLNFHAIRNSSHMITAKAYVLRRINSRLPSQELPSDTWPSSEISDLADPHFHKPGSIDVLLGAVVYAHIILDGIIKRNESLVALNSRLGWLVSGEVAQSGHQSHNVVVMHTQVEVDQLLRQFWEIDEYSPNMKPLSKLEMQCEEHFKKTHTRNTDGRYEVRLPFKDKDAPNLGNSRQLALKGLHQMENKFKRRPEFHEEYSKFMRQYESLGHMEVVPETEKMNRAYYLPHHAVLIFELPIAFDFCGYVKIRLSKGTIT

Summary

EMBL
ODYU01008608    SOQ52337.1    ODYU01008829    SOQ52773.1    KQ460036    KPJ18393.1    + More
JTDY01004853    KOB67675.1    JTDY01001331    KOB74176.1    LBMM01011051    KMQ87060.1    JTDY01002583    KOB71156.1    LBMM01008464    KMQ88855.1    LBMM01007859    KMQ89359.1    RSAL01000327    RVE42512.1    LBMM01009964    KMQ87756.1    LBMM01017223    KMQ84153.1    GEZM01060253    JAV71158.1    LBMM01009645    KMQ87967.1    LBMM01009746    KMQ87900.1    LBMM01009898    KMQ87805.1    GEZM01060254    JAV71154.1    LBMM01011423    KMQ86851.1    LBMM01012568    KMQ86144.1    LBMM01010405    KMQ87487.1    LBMM01012708    KMQ86040.1    LBMM01016077    KMQ84566.1    LBMM01015575    KMQ84755.1    KK114194    KFM61875.1    LBMM01009284    KMQ88248.1    LBMM01016480    KMQ84410.1    LBMM01010417    KMQ87475.1    LBMM01006490    KMQ90572.1    NWSH01000070    PCG79985.1    LBMM01008324    KMQ88972.1    QOIP01000012    RLU15613.1    LNIX01000026    OXA42254.1    LBMM01011492    KMQ86800.1    LNIX01000005    OXA53452.1    GAMC01003146    JAC03410.1    LBMM01011516    KMQ86784.1    KQ981619    KYN39239.1    LBMM01012077    KMQ86420.1    LNIX01000002    OXA59522.1    LBMM01009688    KMQ87939.1    LBMM01009551    KMQ88039.1    KQ458473    KPJ05885.1    LNIX01000007    OXA51795.1    LBMM01008872    KMQ88568.1    KZ149989    PZC75621.1    GGMR01017803    MBY30422.1    LNIX01000016    OXA46198.1    LBMM01004572    KMQ92278.1    GBHO01005506    GBHO01005503    JAG38098.1    JAG38101.1    KQ978058    KYM97736.1    OXA54553.1    OXA54559.1    KQ978502    KYM93417.1    KQ981002    KYN10407.1    AJ487856    CAD32253.1    ODYU01012875    SOQ59395.1    GEZM01078370    GEZM01078366    GEZM01078363    JAV62757.1    GAMC01020546    JAB86009.1    LBMM01016966    KMQ84252.1    KQ976954    KYN06860.1    LBMM01017818    KMQ83962.1    KQ977557    KYN02007.1    LNIX01000063    OXA37200.1    ABLF02023723    LBMM01017192    KMQ84171.1    GFTR01008874    JAW07552.1    KQ460211    KPJ16510.1    QOIP01000013    RLU15366.1    KQ977080    KYN05933.1    OXA54454.1    LBMM01015547    KMQ84766.1    LBMM01009888    KMQ87813.1    LNIX01000036    OXA39969.1    ABLF02008594    LBMM01007770    KMQ89434.1    LBMM01013941    KMQ85408.1    QOIP01000005    RLU22365.1    ABLF02042806    KQ977526    KYN02131.1    LJIJ01005839    ODM87229.1    KQ458793    KPJ04955.1    GGMR01009911    MBY22530.1    OXA60848.1    LNIX01000018    OXA45284.1    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    ABLF02028666    ABLF02066713    KQ982204    KYQ59009.1    GGMR01018506    MBY31125.1    KQ460545    KPJ14069.1    KQ977691    KYN00577.1    ABLF02035780    LBMM01010986    KMQ87097.1    GEHC01000865    JAV46780.1    GBBI01004139    JAC14573.1    GBBI01004140    JAC14572.1    KQ979016    KYN24380.1    KQ415050    KOC58845.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF03564   DUF1759
PF05380   Peptidase_A17
PF18701   DUF5641
PF00008   EGF
PF00078   RVT_1
PF13843   DDE_Tnp_1_7
PF00665   rve
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00230   MIP
PF12259   Baculo_F
Interpro
IPR001584   Integrase_cat-core        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001878   Znf_CCHC       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR000253   FHA_dom       
IPR000742   EGF-like_dom       
IPR011042   6-blade_b-propeller_TolB-like       
IPR013032   EGF-like_CS       
IPR000033   LDLR_classB_rpt       
IPR029526   PGBD       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR000425   MIP       
IPR023271   Aquaporin-like       
IPR022048   Envelope_fusion-like       
IPR000727   T_SNARE_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF81338   SSF81338       

Ontologies

Topology

Length:
771
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.95408
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00027
outside
1  -  771
 
 

Population Genetic Test Statistics

Pi
411.324887
Theta
220.18091
Tajima's D
2.921772
CLR
0.249345
CSRT
0.974101294935253
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号