SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09856
Annotation
transposase_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.068 Nuclear   Reliability : 1.521
 

Sequence

CDS
ATGGTTTGGTGGGGTCTTAGCTATGAAGGAGTGACTGAGCCATACTTTTGTGAAAAAGGTATCAAAACATTGGCACAAGTGTATCAAGATACTATTCTTGAGAAGGTTGTGAAGCCCCTTAACAACACCATGTTCAATAATCAAGAATGGTCCTTCCAGCAAGACTCGGCGCCAGGTCATAAAGCTCGGTCTACGCAGTCTTGGTTGGAAACGAAAGTTTCGGACTTCATCAGAGCTGAAGACTGGCCGTCGTCTAGTCCCGATCTTAATCCGCTGGATTATGATATATGGTCAGTTTTAGAGAGTACAGCTTGCTCTAAACGACATGATAATTTGGAGTCCCTAAAACAATCCGTACGATTGGCAGTGAAATTTTTTCCCATGGAAAGAGTGCGTGCTTCTATTGATAACTGGCCTCAACGTTTAAAGGACTGTATTGCAGCCAATGGAGACCACTTCGAATAA
Protein
MVWWGLSYEGVTEPYFCEKGIKTLAQVYQDTILEKVVKPLNNTMFNNQEWSFQQDSAPGHKARSTQSWLETKVSDFIRAEDWPSSSPDLNPLDYDIWSVLESTACSKRHDNLESLKQSVRLAVKFFPMERVRASIDNWPQRLKDCIAANGDHFE

Summary

Similarity
Belongs to the TGF-beta family.
EMBL
U47917    AAB47739.1    JF779677    AEO90418.1    AF461149    AAN06610.1    + More
AB363006    AB363010    AB363014    BAG15923.1    BAG15924.1    AB473770    BAH20555.1    AB363028    BAG15927.1    AB363018    BAG15926.1    RSAL01000084    RVE48403.1    RSAL01000012    RVE53510.1    LNIX01000030    OXA41211.1    RSAL01000114    RVE46946.1    ODYU01006378    SOQ48174.1    RSAL01000174    RVE45058.1    RSAL01000392    RVE41996.1    JARK01001411    EYC06502.1    UYSL01019905    VDL71189.1    KN728435    KIH63782.1    JOJR01000583    RCN36166.1    JOJR01000015    RCN51257.1    UZAH01000669    VDO19161.1    KA646003    AFP60632.1    CH902625    KPU75512.1    UZAH01026445    VDO80847.1    JARK01001601    EYB87313.1    RSAL01001770    RVE40705.1    CAVP010059404    CDL95787.1    RSAL01000021    RVE52408.1    UZAH01031030    VDP13493.1    CAVP010058332    CDL94449.1    JARK01001345    EYC27589.1    JARK01000059    EYC44525.1    KN769991    KIH46151.1    JARK01001337    EYC34439.1    KX931010    APL98300.1    UZAH01001595    VDO19836.1    JARK01001418    EYC05389.1    HE601413    CAS00486.1    UZAH01025744    VDO69727.1    PDUG01000012    PIC13506.1    JARK01000176    EYC41234.1    UYSL01009772    VDL68385.1    UYSL01022144    VDL79905.1    KN728607    KIH63514.1    DS268433    EFO97645.1    DS268492    EFP11674.1    PDUG01000005    PIC28734.1    DS268747    EFP00909.1    DS268420    EFO87874.1    DS268428    EFO94379.1    DS268606    EFO93488.1    DS268508    EFO83264.1    DS268679    EFO98285.1    PIC31069.1    DS268466    EFP06959.1    PDUG01000006    PIC20538.1    JARK01001471    EYB97976.1    DS268421    EFO88618.1    DS268673    EFO98001.1    UYSL01021399    VDL78127.1    EFP11689.1    DS268612    EFO94085.1    PIC23776.1    DS268539    EFO88027.1    DS268525    EFO85497.1    JARK01001658    EYB84158.1    CAVP010058755    CDL95145.1    KI662043    ETN73029.1    PIC29926.1    UYSL01002425    VDL65835.1    DS268545    EFO88382.1    PDUG01000001    PIC51673.1   
Pfam
PF00019   TGF_beta        + More
PF00431   CUB
PF13358   DDE_3
PF07992   Pyr_redox_2
PF00292   PAX
Interpro
IPR009057   Homeobox-like_sf        + More
IPR001839   TGF-b_C       
IPR029034   Cystine-knot_cytokine       
IPR017948   TGFb_CS       
IPR015615   TGF-beta-rel       
IPR000859   CUB_dom       
IPR035914   Sperma_CUB_dom_sf       
IPR038717   Tc1-like_DDE_dom       
IPR036188   FAD/NAD-bd_sf       
IPR023753   FAD/NAD-binding_dom       
IPR036388   WH-like_DNA-bd_sf       
IPR036259   MFS_trans_sf       
IPR001523   Paired_dom       
SUPFAM
SSF46689   SSF46689        + More
SSF57501   SSF57501       
SSF49854   SSF49854       
SSF51905   SSF51905       
SSF103473   SSF103473       
PDB
5CR4     E-value=1.89782e-07,     Score=126

Ontologies

Topology

Subcellular location
Secreted  
Length:
154
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.05286
outside
1  -  154
 
 

Population Genetic Test Statistics

Pi
89.591127
Theta
92.582844
Tajima's D
0.137588
CLR
173.759115
CSRT
0.404729763511824
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号