SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09855
Annotation
PREDICTED:_uncharacterized_protein_LOC105391048_[Plutella_xylostella]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Mitochondrial   Reliability : 1.992
 

Sequence

CDS
ATGGTCATAAATAGTTCCAACTGTGTTTTCGGAGTTGAAAAGGTGCAGTTTCTGGGATACACGATCTCAGCTGAAGGAACAACACCTCTCGAAGCCAAAGTAGAAGCCATCCATAACTTTCCTGAGCCGAAAACCATAAAACAGCTTAGAAGGTTCCTAGGGATGCTTAATTTTTACAGAAGATTTATACAATCAGCTGCACAAACTCAAACTGCATTGAACAACCTCCTTACAGGCTCAGTGAAGGGCTCACATCCTGTCAACTTTAACGAACAGGAACTAAAAGCATTTCGAGACTGTAAAGATAGTCTGTGCCGTGCCACATTATTGGCACATCCAGACTGCGAGGCACCACTGGCATTGGTCACAGATGCATCTGAGAACGCTATCGGCGCTGTACTCCAACAATACAAGAATCGAGGATGGCAACCATTGGCATTCTTTTCGCGCAAGCTAAGTCCCAGTCAATTCAAATACTCACCTTACGATCGCGAGTTGCTTGCGATATATGAATCAGTCCGGTATTTCCTTCACATGCTGGAAGCTCGAAATTTCACAATTTACACGGACCACAAACCTATGACGTTCGCATTCCACGCACGTAAAGAAAAAGGCTCGCCCAGACAACATTGTCACCTGGAATTCATATCTCAGTTCACCACTGACATCCGTCACATTTCGGGCAAGGACAACGTAGTGGCTGACACGCTATCTAGAATAGAAGAAGTAATAGCACCACTGGACTATGCACAGCTAGCTAAAGATCAAGCCGTTGATGCAGAGCTCCAAGATCTGTTAAAAGAGGGATCGTCGCTGCGTCTTACAAAAATCCAAATTCCTGCAACAACAACCAGCGTATACTGTGATATCAGCACTGAACACACCAGACCGTTCATAATAAGACAGTTTAAACGTCAAGTTTTTGATAATATCCATGGCCTCAGTCACCCAGGCGCCAATGCTACAATCAAGCTAATCTCACAGCGCTTCGTATGGCCCGGTATAAACAAGGATTGTAGAAACTGGACTCGATCGTGCTATGCATGTCAACGTGCCAAAGTAACACGCCATGTATCAGCACCTCTAGGCACTTACCAGCTACCTCAAGCCAGATTCCAACAAATCCATATTGATCTGATTGGACCTCTACCGATATCACAAGGTTACCGCTATTGTCTAACTGTCGTAGATCGCTTTACAAGATGGTCTGAAGTAGCACCATTAACCGACATAACAGCAGAAACAGTAGCCAAGGCTCTACTAACACGCTGGGTGTCAAGATTTGGCTGCCCTACAGAAATAGTCACAGACCGAGGAACTCAATTTGAATCATAG
Protein
MVINSSNCVFGVEKVQFLGYTISAEGTTPLEAKVEAIHNFPEPKTIKQLRRFLGMLNFYRRFIQSAAQTQTALNNLLTGSVKGSHPVNFNEQELKAFRDCKDSLCRATLLAHPDCEAPLALVTDASENAIGAVLQQYKNRGWQPLAFFSRKLSPSQFKYSPYDRELLAIYESVRYFLHMLEARNFTIYTDHKPMTFAFHARKEKGSPRQHCHLEFISQFTTDIRHISGKDNVVADTLSRIEEVIAPLDYAQLAKDQAVDAELQDLLKEGSSLRLTKIQIPATTTSVYCDISTEHTRPFIIRQFKRQVFDNIHGLSHPGANATIKLISQRFVWPGINKDCRNWTRSCYACQRAKVTRHVSAPLGTYQLPQARFQQIHIDLIGPLPISQGYRYCLTVVDRFTRWSEVAPLTDITAETVAKALLTRWVSRFGCPTEIVTDRGTQFES

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
LBMM01011855    KMQ86587.1    GEDC01031421    JAS05877.1    LBMM01012479    KMQ86204.1    + More
LBMM01009142    KMQ88359.1    LBMM01013040    KMQ85849.1    GFXV01006394    MBW18199.1    LBMM01013103    KMQ85815.1    LBMM01012030    KMQ86466.1    LBMM01008151    KMQ89105.1    LBMM01006500    KMQ90563.1    GEZM01017686    JAV90495.1    KL367555    KFD64489.1    KL367492    KFD69854.1    LBMM01012134    KMQ86388.1    GGMR01003899    MBY16518.1    GBXI01003773    JAD10519.1    IAAA01040175    LAA10459.1    KL363241    KFD51254.1    MRZV01001127    MRZV01000556    PIK40396.1    PIK47817.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    GBXI01015889    JAC98402.1    LN877232    CTR11708.1    AAGJ04130731    GEGO01001281    JAR94123.1    KL367552    KFD64647.1    MRZV01001828    PIK35719.1    GEZM01036621    JAV82565.1    ABLF02030693    ABLF02030697    IAAA01033850    LAA08869.1    AAGJ04172791    ABLF02032144    GBHO01011167    GBHO01011165    GBHO01011164    JAG32437.1    JAG32439.1    JAG32440.1    GDHC01002934    JAQ15695.1    BK004066    DAA04495.1    LBMM01012567    KMQ86146.1    GGMR01010038    MBY22657.1    GEGO01003687    JAR91717.1    KL367564    KFD63933.1    GBXI01017046    JAC97245.1    KQ973093    EFA13472.2    QCYY01002214    ROT72055.1    GEGO01004475    JAR90929.1    AY662653    AAT98609.1    GEGO01000286    JAR95118.1    AAGJ04112098    EF426679    ABP48077.1    GAKP01013651    JAC45301.1    GEDV01008182    JAP80375.1    QMKO01001896    RTG85859.1    GEGO01003506    JAR91898.1    QMKO01001891    RTG85893.1    GACK01008900    JAA56134.1    KQ971355    EFA07205.2    GAMC01010904    JAB95651.1    BN000802    CAJ00250.1    CAAE01014565    CAF98772.1    BK004070    DAA04500.1    GEGO01004686    JAR90718.1    LBMM01012160    KMQ86374.1    CABG01000050    CAZ37786.2    CAAE01013629    CAF95050.1    GFPF01012375    MAA23521.1    GAKP01008886    JAC50066.1    GEGO01004649    JAR90755.1    GFDL01003994    JAV31051.1    GEGO01004569    JAR90835.1    AAGJ04001742    GBHO01029676    JAG13928.1    GDKW01003376    JAI53219.1    GBXI01002896    JAD11396.1    GBRD01008235    JAG57586.1    GDHC01006393    JAQ12236.1    GEGO01004484    JAR90920.1    CABG01000001    CCD58591.1    AAGJ04032598    GDHF01001116    JAI51198.1    GEDV01001796    JAP86761.1    GEEE01013406    JAP49819.1    GDHF01021808    JAI30506.1    LBMM01001181    KMQ96765.1    GDHF01014424    JAI37890.1    LBMM01012633    KMQ86092.1    GGFK01003442    MBW36763.1    GGFK01003401    MBW36722.1    EU780138    ACI45976.1    GBHO01015475    JAG28129.1    GGLE01003443    MBY07569.1    DF142933    GAA49140.1    GGLE01002534    MBY06660.1    GCES01089026    JAQ97296.1    QPMK01000035    RDD64024.1    GBYB01009311    JAG79078.1    GGLE01001814    MBY05940.1    FN356212    CAX83701.1    ABLF02007585    AAZX01006801    AAZX01023483    KN538487    KHJ39859.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF17917   RT_RNaseH
PF01087   GalP_UDP_transf
PF01501   Glyco_transf_8
PF13359   DDE_Tnp_4
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR000477   RT_dom       
IPR001995   Peptidase_A2_cat       
IPR021109   Peptidase_aspartic_dom_sf       
IPR034132   RP_Saci-like       
IPR001969   Aspartic_peptidase_AS       
IPR013032   EGF-like_CS       
IPR041373   RT_RNaseH       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR029044   Nucleotide-diphossugar_trans       
IPR002495   Glyco_trans_8       
IPR027806   HARBI1_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF53448   SSF53448       
PDB
4OL8     E-value=1.22039e-33,     Score=359

Ontologies

Topology

Length:
444
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0061
Exp number, first 60 AAs:
0.00296
Total prob of N-in:
0.00446
outside
1  -  444
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.095308
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号