SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09854
Pre Gene Modal
BGIBMGA013151
Annotation
PREDICTED:_fatty_acid_synthase-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.255
 

Sequence

CDS
ATGGCCCCTACACCTCAAGACAACAAGGTACTAGAAGATGTACCGAAGCAACCTGTCATCGGCGAAAGGGTTGTAATTTCCGGAATGTCTGGCCTGTACCCTGACTGTAAATCTGTTAAGGATTTGGCAGATATTTTGTATAATAAGAAAGATCCTATAACATCCGAGCGTCAACGTTGGAGTTATTCCCACCCTGAAGTGTCACAATGCACTGGAAAGCTCCTTGATCTTGACCGTTTCGATGCTCAATTCTTCAAGGTGCATTTTCGTCTTGGAAACAGCATGGATTCAATGGGAAGAAAAGTGCTGGAGCAAACATATCAAGCAATATATGATGCCGGTGTTAATCCACAACATCTTGCTGGAAAAAAAGTAGGAGTGTACATTGGGACATGTTTCTCTGAAACTGAAAAGACTAGCTTTTATGTAGCTAACTCTAGGACAGGTTTTGGCATTGCAGGGTGCAGCAAAACTATGTTTGCAAATCGTATTTCATACTGGTTAAATGTCAAAGGACCGTCGATGGCAATAGACGAAGCCTGTTGTAGCTCTACTGCAGCTATTGAACAAGCCTACCTCGCCATGACTCGAGGGGAATGCGAAGCGGCTATCGTCGGAGGAACTAACATATGCCTTCATCCACATTCCTTGATTCATCACGGAAGGCTCTTGACTATTTGCATGGATGCGAAAACGAAATCCTTCGATCAAAACGCAGATGGTTGTGCCAAATCGGAAGCTATAAACGTTTTATTTCTTCAGAAGGCCGAAAATGCGCTCAGAGTTTACGCAGAAATTGTTTTTGTGAAAACAGAATTTACGGCTTTACCAAATGCCGTAACTGGACCAAAGTTTGGATTTTGTCGTGATCCAGATGTCATAGCGAATTTCCTAAAGAAGTTGTATGAAAATGCTGGAGTGTCACCTGATGCTGTTGAATACGTAGAAGCTTTTGGGTCAGGTGAATAA
Protein
MAPTPQDNKVLEDVPKQPVIGERVVISGMSGLYPDCKSVKDLADILYNKKDPITSERQRWSYSHPEVSQCTGKLLDLDRFDAQFFKVHFRLGNSMDSMGRKVLEQTYQAIYDAGVNPQHLAGKKVGVYIGTCFSETEKTSFYVANSRTGFGIAGCSKTMFANRISYWLNVKGPSMAIDEACCSSTAAIEQAYLAMTRGECEAAIVGGTNICLHPHSLIHHGRLLTICMDAKTKSFDQNADGCAKSEAINVLFLQKAENALRVYAEIVFVKTEFTALPNAVTGPKFGFCRDPDVIANFLKKLYENAGVSPDAVEYVEAFGSGE

Summary

Similarity
Belongs to the thiolase-like superfamily. Beta-ketoacyl-ACP synthases family.
EMBL
BABH01022903    ODYU01009786    SOQ54441.1    JTDY01003263    KOB69849.1    ODYU01009787    + More
SOQ54442.1    AGBW02011888    OWR45966.1    KQ461178    KPJ07769.1    NWSH01000156    PCG78967.1    ODYU01000872    SOQ36288.1    KQ459602    KPI93194.1    PCG78966.1    JTDY01003390    KOB69631.1    PCG78965.1    RSAL01000013    RVE53442.1    KOB69848.1    JTDY01006902    KOB65606.1    RSAL01000223    RVE44005.1    RSAL01000068    RVE49259.1    U67866    AAB53257.1    JTDY01011546    KOB55720.1    JTDY01001031    KOB75079.1    KZ150116    PZC73268.1    NWSH01000591    PCG75471.1    GEDC01024813    JAS12485.1    GBYB01008708    JAG78475.1    GL765434    EFZ16301.1    GECZ01010430    JAS59339.1    AGBW02007651    OWR55047.1    RSAL01000071    RVE49124.1    KQ977574    KYN01849.1    KQ976440    KYM86527.1    ADTU01005072    ADTU01005073    ADTU01005074    ADTU01005075    DS235784    EEB16951.1    ODYU01002246    SOQ39472.1    KQ981856    KYN34617.1    KK852680    KDR18643.1    GECU01021338    JAS86368.1    GECU01006695    JAT01012.1    U67867    AAB53258.1    NWSH01003873    PCG65733.1    PCG65731.1    GL445739    EFN89136.1    NNAY01001760    OXU23005.1    KQ460651    KPJ13003.1    KK854269    PTY14005.1    GFXV01006890    MBW18695.1    GL888175    EGI66082.1    GGMS01017661    MBY86864.1    KQ978607    KYN29892.1    ABLF02036897    KM507100    AKM28424.1    KQ459582    KPI99075.1    KK107139    EZA57700.1    GL438820    EFN68400.1    ODYU01002244    SOQ39469.1    NEVH01022635    PNF18739.1    NNAY01001038    OXU25389.1    PCG78963.1    KQ434960    KZC12654.1    CCAG010017947    ODYU01002245    SOQ39471.1    PYGN01001841    PSN32561.1    GEBQ01017893    JAT22084.1    JXUM01076840    KQ562972    KXJ74732.1    KZ288370    PBC26760.1    BABH01033622    BABH01033623    BABH01033624    CH477489    EAT40085.1    JXJN01010482    JXJN01010483    JRES01001625    KNC21349.1    GL435066    EFN74070.1    GL442834    EFN62855.1    KQ761246    OAD57941.1    DS231997    EDS30986.1    CCAG010013878    PNF18741.1    JTDY01000529    KOB76786.1    AE014296    EAA46042.3    KA644718    AFP59347.1    CM000070    EDY68457.3    GDHF01026736    JAI25578.1    KQ435885    KOX69550.1    CH893166    KRK05689.1    CH954177    EDV60008.2    KQ414663    KOC65238.1    ADMH02002134    ETN58382.1    GFDL01004709    JAV30336.1   
Pfam
PF02801   Ketoacyl-synt_C        + More
PF00109   ketoacyl-synt
PF00698   Acyl_transf_1
PF16197   KAsynt_C_assoc
PF00107   ADH_zinc_N
PF14765   PS-DH
PF08659   KR
PF00975   Thioesterase
PF00550   PP-binding
PF07690   MFS_1
Interpro
IPR020801   PKS_acyl_transferase        + More
IPR014030   Ketoacyl_synth_N       
IPR016039   Thiolase-like       
IPR001227   Ac_transferase_dom_sf       
IPR020841   PKS_Beta-ketoAc_synthase_dom       
IPR016035   Acyl_Trfase/lysoPLipase       
IPR014031   Ketoacyl_synth_C       
IPR016036   Malonyl_transacylase_ACP-bd       
IPR014043   Acyl_transferase       
IPR042104   PKS_dehydratase_sf       
IPR032821   KAsynt_C_assoc       
IPR020843   PKS_ER       
IPR036291   NAD(P)-bd_dom_sf       
IPR011032   GroES-like_sf       
IPR013149   ADH_C       
IPR023102   Fatty_acid_synthase_dom_2       
IPR029058   AB_hydrolase       
IPR020807   PKS_dehydratase       
IPR013968   PKS_KR       
IPR001031   Thioesterase       
IPR018201   Ketoacyl_synth_AS       
IPR036736   ACP-like_sf       
IPR009081   PP-bd_ACP       
IPR020806   PKS_PP-bd       
IPR020846   MFS_dom       
IPR036259   MFS_trans_sf       
IPR011701   MFS       
IPR006162   Ppantetheine_attach_site       
SUPFAM
SSF53901   SSF53901        + More
SSF52151   SSF52151       
SSF55048   SSF55048       
SSF50129   SSF50129       
SSF51735   SSF51735       
SSF53474   SSF53474       
SSF47336   SSF47336       
SSF103473   SSF103473       
PDB
3HHD     E-value=1.80201e-57,     Score=563

Ontologies

Topology

Length:
322
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01605
Exp number, first 60 AAs:
0.00015
Total prob of N-in:
0.03057
outside
1  -  322
 
 

Population Genetic Test Statistics

Pi
189.296887
Theta
149.933981
Tajima's D
0.246215
CLR
0.212398
CSRT
0.437778111094445
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号