SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09853
Pre Gene Modal
BGIBMGA014486
Annotation
PREDICTED:_uncharacterized_protein_LOC105842680_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 1.541
 

Sequence

CDS
ATGGGGGATACAAAAAGGCAAAACTCGCAAAACAACCATCACTACGGTTATTTTAGGCTATGTCAACTAAATGATCCAGCTATAAAAACTGACCAGCAAAAAAGAATACTCGTGAAACAAGATCCATCAAATGCTGCTTATTTTCAGATACTCATGGAAAAAATTGGTGTCGGTAACAATTTCTACTTGCTTGGGTGTGATATTGGAATTTTGATTGCGATGGAACTAGCTGCAATACTTGAGAAAAATGGTTTTTTGGGCACCATATTTTGTCTCGGAACTACACCAGAAGACGTCAAACCAGTAATTGAACAACAACTAGGCGCGTTCTCAACAGAAGACCAACTGCAGCTTGGAATTTTAAAACATATTTTTACGCTACTAACTGGTGAAGTACCATCAGATTTAGATGAAACTCTGTACCTTCACTCTTCATGGAATGAAAAAATTGACGCTTGTATCAAAATAATGGCCGATCGTATAACACAAACAAAGCAATATGTGAAAGCGTTAATAAATTTCGTCTATGAAATAATTCTGAGCATCAAACAGTATGAATCTTCAGCTTTGCCAACACTGAAGTCTAGAGTCGTGATACTCCGCTCCCCAGGATATTCGTCAACTTCATCTGCATCATCATACGTAATTGAAGATATATCAGCACCACTTTGTGATGCTGCAAAAGATGTGCGATGTGCAGCCGTCATCAATGACAATTTGTCAACTGAAATATTGAAAGAATTCAAAACGAAGAACCTATGTGATATCTTTGTGATAAATTTTGACGACAAGTACGTAAGGGCGTACTAA
Protein
MGDTKRQNSQNNHHYGYFRLCQLNDPAIKTDQQKRILVKQDPSNAAYFQILMEKIGVGNNFYLLGCDIGILIAMELAAILEKNGFLGTIFCLGTTPEDVKPVIEQQLGAFSTEDQLQLGILKHIFTLLTGEVPSDLDETLYLHSSWNEKIDACIKIMADRITQTKQYVKALINFVYEIILSIKQYESSALPTLKSRVVILRSPGYSSTSSASSYVIEDISAPLCDAAKDVRCAAVINDNLSTEILKEFKTKNLCDIFVINFDDKYVRAY

Summary

Pfam
PF02801   Ketoacyl-synt_C        + More
PF00109   ketoacyl-synt
PF00975   Thioesterase
PF00698   Acyl_transf_1
PF16197   KAsynt_C_assoc
PF14765   PS-DH
PF08659   KR
PF00107   ADH_zinc_N
PF07690   MFS_1
PF00550   PP-binding
Interpro
IPR023102   Fatty_acid_synthase_dom_2        + More
IPR029058   AB_hydrolase       
IPR042104   PKS_dehydratase_sf       
IPR032821   KAsynt_C_assoc       
IPR001031   Thioesterase       
IPR014043   Acyl_transferase       
IPR036291   NAD(P)-bd_dom_sf       
IPR016035   Acyl_Trfase/lysoPLipase       
IPR014031   Ketoacyl_synth_C       
IPR020841   PKS_Beta-ketoAc_synthase_dom       
IPR001227   Ac_transferase_dom_sf       
IPR020843   PKS_ER       
IPR014030   Ketoacyl_synth_N       
IPR016039   Thiolase-like       
IPR020801   PKS_acyl_transferase       
IPR011032   GroES-like_sf       
IPR016036   Malonyl_transacylase_ACP-bd       
IPR020807   PKS_dehydratase       
IPR013968   PKS_KR       
IPR013149   ADH_C       
IPR036736   ACP-like_sf       
IPR018201   Ketoacyl_synth_AS       
IPR020846   MFS_dom       
IPR036259   MFS_trans_sf       
IPR011701   MFS       
IPR009081   PP-bd_ACP       
IPR020806   PKS_PP-bd       
SUPFAM
SSF53901   SSF53901        + More
SSF53474   SSF53474       
SSF52151   SSF52151       
SSF51735   SSF51735       
SSF50129   SSF50129       
SSF55048   SSF55048       
SSF103473   SSF103473       
SSF47336   SSF47336       

Ontologies

Topology

Length:
269
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
20.22884
Exp number, first 60 AAs:
2.87585
Total prob of N-in:
0.93503
inside
1  -  56
TMhelix
57  -  79
outside
80  -  269
 
 

Population Genetic Test Statistics

Pi
255.639803
Theta
208.45651
Tajima's D
0.696328
CLR
9.594434
CSRT
0.571521423928804
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号