SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09851
Pre Gene Modal
BGIBMGA013281
Annotation
PREDICTED:_fatty_acid_synthase-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.311 Nuclear   Reliability : 1.068 PlasmaMembrane   Reliability : 1.558
 

Sequence

CDS
ATGAAGGCTTCAGCAGGCAACACTACCACAGATCGAGGCGTGAAGTCTTCATCGGAACGTGACAGGATTGTCATCTCAGGGATGTCAGGTCTGTTTCCTGAGGCGCAATCCGTCCAAGAATTTGCTGATATTCTTTACAATAAGGTAAATCCTGTAACATCAGAGAACAGTCCTTGGTTGTATACACCACTAGAAATTGGCCCGTATTCAGGAAAAGCCCCAGGATCACAATATTTCGATGCACAATTTTTCAAAGTACATCAACGACTTGGAGAAAAAATGGACGTTATGTCGAGGAAGTTGTTGGAGCAATCTTACCAAGCTATTTACGACGCCGGTCTGAGCCCTCAGAGCTTAAATGGTAAAAATGTTGCCGTCTACATAGGTACTTCTATTTCTGAGACAGAAATAACTGGATTTCTTGATACATCTTCCAAGAGAGGTTTTGGAATAATGGGATGTAGTAAAACAATGTTCGCAAATCGTATCTCCTATTGGCTAAATGTAAAAGGTCCTTCCATGGCCGTGGACCAAGCATGTTGCAGCTCTATGAGTGCTCTACAGCTGGCATATCTTGCCATGAAAAGTAATGAATGTGAAGCTGCCATTGTTGGAGGATGTCATTTGAGTATGCTGCCTGAATCATCAGTTCATTACAACAGAATAAACAAGATAGCAAAAGATGGAAAGACTAGGTCGTTTGATCAAGAGGCCAACGGATGTGTTCTCTCTGATGCTATCAATGTTATTTTCTTGCAAAAAGCGAGTGATGCTTTGAGGGTATATGCTGATGTGGTCCATGCTAAGAATGAATACATTTCTTTGAAACAAGAAAATGAGTTTCCGAAGAGCGGATCATATAGGAAACCGCATGAAATTGCAAATTATTTAAAAGATTTTTATATAGAAGCGGATTTCGCCCCACAAGATGTCGACTACGTAGAGGCATTTGGCATCGGTAATCCGGAATCAGATAAATCTGAACTAGAAGCTTTAACTGATGTTTTCTGTGACAAGAAAACTAATCCATTGTATGTAGGCAGCGTGATGTCCAATATAGGTTTTACCGCAGCGGCTAGTGGCATTACATCCATTATAAAAGTGCTCCTTGGCTACCACAACGGTTTATTTGCTGGTAACCTGCATTACAATACGCCACGCCACGACATAAATGCAATAAAAGATGGACGAATTTGTATTCTTGACGATCACTGCCACATTAACGGAAATTACGCAGCAGTCAATGCCTTTTCAGTAACTGGAGTCAATGCTCATGTTCTGTTGAAAGGAAACCGTAAACCAAAGGACTTAGCCAAATATAAATCCAGCATACCACACCTGGTGACAGTATCAGGGAGACAAGATAGTTCAGTAAAAAAAGTACTTGATAATTTAAAATCAAGACCAATAGATCCAGAAGAACTAACATTATTTCACAACATACATTCGGTGGTGACTCCAGGGCACTTGGGAAGAGGCTACACAATTTTGCAAACGCAAGAGAATCAAACAGTAAGTTTAGGAGAAGCAGTGAACTATTTCGATAATGCCAAACGTCCGTTGTGGTTTGTGTACAGTGGGATGGGTTCTCAATGGCCTGGGATGGGCGCGGAACTTATGAATATCCCAATATTTTCCGCAGCTATTGAGCGCTGCCAAAAAGCAGTCGAATCTAAAGGAATAGACCTCGTGAAAATTATAACGTCTACTGATCCTGATATTTTCAATAATATTCTAAACGCTTTCTTGGGTATCGCGGCCATTCAGATCGGTTTGACAGATGTCACCTATGCACTTGGTTTGGTTCCTGATAATATCATTGGACACAGTGTGGGCGAGCTCGGCTGCGCTTATGCCGATGGTTGTCTAACAGCAGAGGAAATGATTTTGGCTGCGTATTCTCGTGGTCAAGCATCCATTGAGACTAAACTCATCAAGGGTTCTATGGCGGCCATCGGGATGGGATACAAACAAATCTTACCTCTGTGTCCTCCAGAAGTAGACGTGGCGTGTCACAACGGACCGGACTCTAGCACTATATCGGGCCCAGCGGATGTGACTGCCCATTTCGTAGCCGAACTGTCAGCCAAAGGAATATTTGCTAAAACAGTTCCTTCTGCGAATATCGCGTATCACTCTCGTTACATAGCTGCTGCTGGCTCCAACCTCTTACAAATGCTGAAGAAGGTCATAAAAAATCCACGTCTTCGTAGTGAACGTTGGGTTTCCACGTCTGTTCCTCAAGAGGATTGGAATAATGCAGCAGCCAAATACTGTTCCCCTGAATACCAAACTAATAATTTGTTGAACCCAGTTCTATTCGAGGAAACATCTCGACTTATCCCAAACAACGCCATTCTCATAGAAATAGCTCCACGTGGACTGCTACAGGCCATTCTGAAACGTTCAGTATCACCAGATTGCTTTAATATATCGTTAACTAAAAAAGGAGATGGTAACGTCATACATTTACTTCAAACCATTGGGAAGCTATACATTGAAGGATGCACACCAGACATCAAGGCTTTGTACCCAAAAGTAGAGTTACCAGTTTCAGCAGGGACTCCCATGCTATCACAATTAGTTAAATGGATGCATCTACAGGAATGGTACGTTCCAAAGCCACAAAGTACTGAAATAATAACTTGTGCAGTCTGCGAACATTTCATATCTGTGCATGACAAAGAGCATAGTTATTTAAGAGGAAACATTGCTCAAGGGAAAATGATATATCCTATTGGAGGAATTTTAGTTCTAGTTTGGGACACGTTATGCATGTCGATGCTATTGCCCAAAAAGAAGGTGTCGGTTAAATTTAGCGACGTTCATATAGAAGTGCAACCAATACTTTGCGAAGAAAAAATATTAAGACTGCGTGTAGCGATCAACAAGGGAAATGGACGATTTGAGGTTACAAACGCTGGATCTAAAGTTGCAAGTGGAATTATTTTTACTACAAGTAAAAATGTGATTAACAAAATGGATCATGCAGTTACTTCTATGGAACTAAATAAAAACGACGTATATCAACTACTATGGGAAAAAGGATACTCTTTCAGCGAAGAATTCCGTTTGATAAAGAGTGCAAATACGACTTTATCTGAAGCCATCGTAGAATGGCGAGACAACTGGGTGACGCTGATCGAGAATATGCTGCAACTGAATATCTTAAATCAGAACGATAATGGTGTTTCACTACCTGCTAAGATCTCTGACGTTATTCTTAATATTTTTGAACACGAAAAGCCAATATTTTCAAAAGATAGTTCATCCACATTAAAAGTAATTCGGTCTGAAGTATATGATTCGACGGAATGCGGGGGTGTGATCCTTAAGGGTATACGATTTCGTCAAATTCCTAGAATTTCATATCCCACGAGTCTGTTGGTTCCGTCTAGCAAAGACAAAACTGAATTGATAAAGTTGAAAATACAAACTTCCTCTTGTTCAAATACGATGCTTCTAAGCGCAGAACCTGGGAATATAAATTCCATTCATTGGTCTCAAGTCTTTGAACCATCTGGATCCGGAATTCTTGTGAAGGTTCACTACGCAAGTCTTACTCCTATAGATGGTGAAAAGGCAACAGGAGCAGTATCTCATCAAGTGAACGAAATCTGTTATGGTATGGATTACAGCGGTGTTACTGAAAGTGGACATCGTGTGATGGGTATAGTTCATCGAGGTGCTTGTCGAAATTATCTTCGAGCTCACCCTGATCTGTTGTGGCCAGTCCCGGATCACTGGAGTCTCGAAGATGCAGCAACTGTTCCTTTAGCTTATGCGTATGCTTTTTACTGTCTAATGATTAAAGCAAAACTTTATTCGGGTATGAAAATTTTAATACACGAAGGAGCTGGAGCACTCGGCCAGGCTGCCATATCCATTGCTCTTGCACACAAATGTCAAGTGTTCACTACAGTTGGTGACGTGAGAATGAAAAGTTTCTTGAAAAAGCTCTATCCAGAATTGAAAGAACAACACATTGGGAATTCTCGAGATGTGACTTTTGGTGACATGGTACTATCAGCAACAAATGGGAAAGGTTGCGATATTGTAATATGTAGTGTCGAACCCTGGCTCAAACATGTTTCACTTCAATGTGGTGGAGCTTTAAGCATTATAATTGATACGGCACAAATGTACAACCAGAATAAGTTCGAATTGCGTATGAATAGTCTGATCAATGATAGATCCTATGTGATTGCCGATTTTGTGTCCATGTTCGATTTTGCGAAAAATGAAGAATTTAAAAAATTACAAATCCTCGTGAGTGGGGGCATCTCCAAGGGCTACGTGCGACCACTAGGGCGAGTGACTTATGCTGCAGATGAAGCTCCACGAGCTCTACGCCTGTTATCGAAGAGTTGGCATCGAGGACATGTCCTTTTAAGACTTACAGATCGAGCGCTTCCAGCTAGCCTTAGGATTAACTGTACTTCTAAATGCAGCCATTTAATCATCTTCAGCGACGAATATTTTGGTATTCAGTTGGCAAAAAGGCTTATCAATAGAGGTGCCAGAATGTTACATATCTGTTGTTCGAAGCCTTCGTGGTATCTTCAACATCAAACAGAAAATCTTAAATCTCTTGGAGTGAATGTTATCGTTTCTTCAAATAACTTAAATGATTTGGATGATGTTGCAACCGTGCTAAAGAAAACTATAGCAATGGGACCGGTAGAAGGCGTATATTTGACGAGCTTCAAAGATATGGACAATAAATACATATCAAATAGCTTGGAATACCTTGATGTTATGTCACGAAAATTTTGCCCATCCCTCAAATATTTTGCAGTGATCACAAATAGTGAAAACGTCGGAAAACAAACGTCGATTTTCAGAGCAAAGGATAATTTAGTTATTTCACGTATTGAAGTTCAAAAGCCAGATTTTTGTGGGGATACAAATACTGAAGTACTGTTAGACAGAAGAGCTTGGGATCTATCGCTTTTAGGCGCAGTCGAGACAGGACTTTGCTCCAAGCTTCCATTGTTGGTCGCACAAATAAAGACTGAGACGTTGCCGCTGTATCAACAGCTTGCTGATGTCGCTGATCTACCATTATTAAATGAGGCTGGCGACATGACCACTCTACAAGATTTGGCTGCTAGAAGTGACAATATAAAAGTAATTAAGGAATTTTTACGTCTGAAATATCATGTTTGTATTTCGGAACACAACGTTTTGAAGTTAAATAAACATAAACTTCGTGAGATAGATTTTCTTGAAAACAACTTTGAGCACAAACAAGGTTTGGCTGTTTACTTCTCTCACATAGCTGAAGATGAAATCAGTTCCGATACTCCTATATACTTATTGCCTACTCTTGGTAATGAAAATGCGGAAAAACGAGTCGATGCACTGAAGTCTGAGTATTTGTGCGTTGTTCCTGGGATTGAAGGCCATCACGTAAGATTTCGTGGTCTCTGCGAGAGACTCAAACTGCCCGCGCTGGTGCTGCAGCCAAGTTTGGATGTGTTGCACGAAACCATAGAACAAGCCGCTCAACGCTACTCTAAGACACTCATGGAAAAAATTGGTGTCGGTAACACTTTCTACTTGCTTGGGTGCGATAGTGGGATTTTGATTGCGATGGAACTAGCTGCAATACTTGAAGAAAATGGTTTTTTGGGTACAATATTTTGTCTTGGAACTGCACCAGAAGATGTCAAGCCAGTAATTGAACAACAACTAGGCGCGTTCTCAACAGAGGACCAACTGCAGCTTGGAATTTTAAAACATATTTTTACGCTACTAACTGGTGAAGTACCATCAGATTTAGATGAAACTCTGCACCCTCACTCTTCTTGGAATGAAAAAATAGATGCTTATATCAAAATGATGGCCGATCGAATAACACAAACAAAGCAATATGTGAAAGCGATAGTACAATCCGTATATGCAAGAATTCTTAGCATCAAACAGTACGACTCTTCAACTTTGCCTACACTGAAATCTACAGTCGTAATACTCCGCTCTCCAGGATATTCATCAACTTCATCTGCATCGTCATACGTAATTGAAGATTTATCAGCACCACTTTGTGATGCTGCCAAAGATGTGCGATGTGCAGCCATCATCAATAAAAATTTGTCAACTGAAATATTGGAAGAATTCAAAACGAAGAATTTATGTGATAGCTTTGTGATAAATTTTGACGACAATTACTATAAGTAA
Protein
MKASAGNTTTDRGVKSSSERDRIVISGMSGLFPEAQSVQEFADILYNKVNPVTSENSPWLYTPLEIGPYSGKAPGSQYFDAQFFKVHQRLGEKMDVMSRKLLEQSYQAIYDAGLSPQSLNGKNVAVYIGTSISETEITGFLDTSSKRGFGIMGCSKTMFANRISYWLNVKGPSMAVDQACCSSMSALQLAYLAMKSNECEAAIVGGCHLSMLPESSVHYNRINKIAKDGKTRSFDQEANGCVLSDAINVIFLQKASDALRVYADVVHAKNEYISLKQENEFPKSGSYRKPHEIANYLKDFYIEADFAPQDVDYVEAFGIGNPESDKSELEALTDVFCDKKTNPLYVGSVMSNIGFTAAASGITSIIKVLLGYHNGLFAGNLHYNTPRHDINAIKDGRICILDDHCHINGNYAAVNAFSVTGVNAHVLLKGNRKPKDLAKYKSSIPHLVTVSGRQDSSVKKVLDNLKSRPIDPEELTLFHNIHSVVTPGHLGRGYTILQTQENQTVSLGEAVNYFDNAKRPLWFVYSGMGSQWPGMGAELMNIPIFSAAIERCQKAVESKGIDLVKIITSTDPDIFNNILNAFLGIAAIQIGLTDVTYALGLVPDNIIGHSVGELGCAYADGCLTAEEMILAAYSRGQASIETKLIKGSMAAIGMGYKQILPLCPPEVDVACHNGPDSSTISGPADVTAHFVAELSAKGIFAKTVPSANIAYHSRYIAAAGSNLLQMLKKVIKNPRLRSERWVSTSVPQEDWNNAAAKYCSPEYQTNNLLNPVLFEETSRLIPNNAILIEIAPRGLLQAILKRSVSPDCFNISLTKKGDGNVIHLLQTIGKLYIEGCTPDIKALYPKVELPVSAGTPMLSQLVKWMHLQEWYVPKPQSTEIITCAVCEHFISVHDKEHSYLRGNIAQGKMIYPIGGILVLVWDTLCMSMLLPKKKVSVKFSDVHIEVQPILCEEKILRLRVAINKGNGRFEVTNAGSKVASGIIFTTSKNVINKMDHAVTSMELNKNDVYQLLWEKGYSFSEEFRLIKSANTTLSEAIVEWRDNWVTLIENMLQLNILNQNDNGVSLPAKISDVILNIFEHEKPIFSKDSSSTLKVIRSEVYDSTECGGVILKGIRFRQIPRISYPTSLLVPSSKDKTELIKLKIQTSSCSNTMLLSAEPGNINSIHWSQVFEPSGSGILVKVHYASLTPIDGEKATGAVSHQVNEICYGMDYSGVTESGHRVMGIVHRGACRNYLRAHPDLLWPVPDHWSLEDAATVPLAYAYAFYCLMIKAKLYSGMKILIHEGAGALGQAAISIALAHKCQVFTTVGDVRMKSFLKKLYPELKEQHIGNSRDVTFGDMVLSATNGKGCDIVICSVEPWLKHVSLQCGGALSIIIDTAQMYNQNKFELRMNSLINDRSYVIADFVSMFDFAKNEEFKKLQILVSGGISKGYVRPLGRVTYAADEAPRALRLLSKSWHRGHVLLRLTDRALPASLRINCTSKCSHLIIFSDEYFGIQLAKRLINRGARMLHICCSKPSWYLQHQTENLKSLGVNVIVSSNNLNDLDDVATVLKKTIAMGPVEGVYLTSFKDMDNKYISNSLEYLDVMSRKFCPSLKYFAVITNSENVGKQTSIFRAKDNLVISRIEVQKPDFCGDTNTEVLLDRRAWDLSLLGAVETGLCSKLPLLVAQIKTETLPLYQQLADVADLPLLNEAGDMTTLQDLAARSDNIKVIKEFLRLKYHVCISEHNVLKLNKHKLREIDFLENNFEHKQGLAVYFSHIAEDEISSDTPIYLLPTLGNENAEKRVDALKSEYLCVVPGIEGHHVRFRGLCERLKLPALVLQPSLDVLHETIEQAAQRYSKTLMEKIGVGNTFYLLGCDSGILIAMELAAILEENGFLGTIFCLGTAPEDVKPVIEQQLGAFSTEDQLQLGILKHIFTLLTGEVPSDLDETLHPHSSWNEKIDAYIKMMADRITQTKQYVKAIVQSVYARILSIKQYDSSTLPTLKSTVVILRSPGYSSTSSASSYVIEDLSAPLCDAAKDVRCAAIINKNLSTEILEEFKTKNLCDSFVINFDDNYYK

Summary

Pfam
PF02801   Ketoacyl-synt_C        + More
PF14765   PS-DH
PF00109   ketoacyl-synt
PF00698   Acyl_transf_1
PF16197   KAsynt_C_assoc
PF00975   Thioesterase
Interpro
IPR014030   Ketoacyl_synth_N        + More
IPR020843   PKS_ER       
IPR016039   Thiolase-like       
IPR020801   PKS_acyl_transferase       
IPR020841   PKS_Beta-ketoAc_synthase_dom       
IPR029058   AB_hydrolase       
IPR001227   Ac_transferase_dom_sf       
IPR020807   PKS_dehydratase       
IPR016036   Malonyl_transacylase_ACP-bd       
IPR016035   Acyl_Trfase/lysoPLipase       
IPR023102   Fatty_acid_synthase_dom_2       
IPR014031   Ketoacyl_synth_C       
IPR011032   GroES-like_sf       
IPR042104   PKS_dehydratase_sf       
IPR032821   KAsynt_C_assoc       
IPR036291   NAD(P)-bd_dom_sf       
IPR014043   Acyl_transferase       
IPR001031   Thioesterase       
SUPFAM
SSF50129   SSF50129        + More
SSF55048   SSF55048       
SSF53901   SSF53901       
SSF53474   SSF53474       
SSF52151   SSF52151       
SSF51735   SSF51735       
PDB
2VZ9     E-value=0,     Score=1828

Ontologies

Topology

Length:
2059
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.75677000000002
Exp number, first 60 AAs:
0.00145
Total prob of N-in:
0.11105
outside
1  -  2059
 
 

Population Genetic Test Statistics

Pi
223.750767
Theta
184.990128
Tajima's D
0.277094
CLR
1.052928
CSRT
0.444527773611319
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号