SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09850
Pre Gene Modal
BGIBMGA013281
Annotation
Uncharacterized_protein_OBRU01_16488?_partial_[Operophtera_brumata]
Location in the cell
Extracellular   Reliability : 1.791 Mitochondrial   Reliability : 1.245
 

Sequence

CDS
ATGACAAGACAAGACGTGCTTTTCAGATGTAGTAAAACAATGTTCGCAAATCGTATCTCCTATTGGCTAAATGTAAGAGGTCCTTCCATAGCCGTCGACCTAGCATGCTGCAGCTCTATGAGTGCTCTACAGCTGGCATATCTTGCCATGAAAAGTGGTGAATGTGAAGCTGCCATTGTTGGAGGATGTCATTTGTGTACGCTGCCTGAATCATCAGTTCATTACAACAGAATAAACTCGATAGCAACGGATGGAAAAACTAGGTCGTTTGATCAAGAGGCCAACGGATGTGTTCTTTCTGATGCAATCAATGTTATTTTCTTACAAAAAGCGAGTGATGCTTTGAGGGTATACGCTGATGTGGTCCACGCCAAGAATGAATACATTTCTTTCAAACAAGAAAATGAGTTTCCCAAGAGCGGATCATATAGGAAACCGCATGAAATTGCAAGTTTTTTGAAAGAATTTTATAAAGAAGCGGAATTCGCCCCACAAGATGTCGACTACGTAGAGGCATTTGGCATCGGTAATCCGGAATCAGATAAATCTGAACTAGAAGCTTTGACTGATGTTTTCTGTGACAAGAAAACTAATCCATTGTATGTAGGCAGCGTGATGTCCAATATAGGTTTTACCGCAGCGGCTAGTGGCATTACATCCATTATAAAAGTGCTCCTCGGCTACCAAAACGGTTTATTTGCTGGTAACCTACATTACAATAAGCCGCGCCACGACATAAATGCAATAAAAGACGGGCGAATTTGTATTCTTGACGATCACTGCCACATTAACGGAAATTACGCAGCAGTCAATGCCTTTTCAGTAACTGGAGTCAATGCTCATGTTTTGTTGAAAGGAAACCGTAAACCAAAGGACTTAGCCAAATATAAATCCAACATACCACACCTGGTGACAGTATCAGGAAGGCAAGATACTTCAGTAAAAAAAGTACTCGATAATTTAAAATCAAGACCAATAGATCCAGAAGAACTAACATTATTTCACAACATACATTCGGTGGTGACTCCAGGGCATTTGGGAAGAGGATACACAATTTTGGGTAAGTAG
Protein
MTRQDVLFRCSKTMFANRISYWLNVRGPSIAVDLACCSSMSALQLAYLAMKSGECEAAIVGGCHLCTLPESSVHYNRINSIATDGKTRSFDQEANGCVLSDAINVIFLQKASDALRVYADVVHAKNEYISFKQENEFPKSGSYRKPHEIASFLKEFYKEAEFAPQDVDYVEAFGIGNPESDKSELEALTDVFCDKKTNPLYVGSVMSNIGFTAAASGITSIIKVLLGYQNGLFAGNLHYNKPRHDINAIKDGRICILDDHCHINGNYAAVNAFSVTGVNAHVLLKGNRKPKDLAKYKSNIPHLVTVSGRQDTSVKKVLDNLKSRPIDPEELTLFHNIHSVVTPGHLGRGYTILGK

Summary

EMBL
BABH01022930    JTDY01003390    KOB69631.1    KQ461178    KPJ07769.1    KQ459602    + More
KPI93194.1    AGBW02011888    OWR45966.1    BABH01022903    ODYU01009787    SOQ54442.1    NWSH01000156    PCG78966.1    PCG78967.1    ODYU01000872    SOQ36288.1    JTDY01003650    KOB69211.1    JTDY01000102    KOB78858.1    JTDY01001031    KOB75079.1    JTDY01003263    KOB69848.1    PCG78965.1    RSAL01000013    RVE53442.1    RSAL01000223    RVE44005.1    JTDY01009790    KOB62677.1    RVE53445.1    JTDY01002311    KOB71689.1    ODYU01007677    SOQ50673.1    JTDY01011546    KOB55720.1    ODYU01009786    SOQ54441.1    NWSH01000591    PCG75472.1    U67866    AAB53257.1    RVE44007.1    PCG78963.1    JTDY01011485    KOB56154.1    ODYU01012610    SOQ59025.1    RSAL01000068    RVE49259.1    KQ460598    KPJ13817.1    PCG75471.1    KQ459053    KPJ04124.1    KPJ04123.1    GEDC01024813    JAS12485.1    JTDY01006902    KOB65606.1    KQ461073    KPJ09498.1    GEBQ01010560    JAT29417.1    GBYB01008708    JAG78475.1    GEBQ01017893    JAT22084.1    KPJ04122.1    KK852680    KDR18643.1    NNAY01001038    OXU25389.1    RSAL01000008    RVE53970.1    GEDC01016862    GEDC01012243    JAS20436.1    JAS25055.1    GEDC01031722    GEDC01008387    JAS05576.1    JAS28911.1    GEDC01031101    GEDC01028079    GEDC01018856    GEDC01013285    JAS06197.1    JAS09219.1    JAS18442.1    JAS24013.1    JTDY01000529    KOB76786.1    ABLF02036897    NNAY01001760    OXU23005.1    BABH01033637    GGMS01017661    MBY86864.1    RSAL01000071    RVE49124.1    KM507100    AKM28424.1    GFXV01006890    MBW18695.1    OXU23004.1    LNIX01000004    OXA55963.1    KZ150116    PZC73268.1    GECZ01010430    JAS59339.1    GECU01021338    JAS86368.1    GECU01006695    JAT01012.1    NEVH01006580    PNF37601.1    ODYU01000212    SOQ34605.1    GL765434    EFZ16301.1    ADTU01005072    ADTU01005073    ADTU01005074    ADTU01005075    KQ977574    KYN01849.1    KQ976440    KYM86527.1    KQ981856    KYN34617.1    KQ770827    OAD52584.1    U67867    AAB53258.1    KQ459582    KPI99075.1    RVE53971.1    KQ435796    KOX73549.1    JQ177158    AEY83835.1    NNAY01001061    OXU25291.1    GL442834    EFN62855.1    JN982132    AEW43642.1    KQ981954    KYN32228.1    GL888565    EGI59473.1    ADTU01010333    ADTU01010334    GL888175    EGI66082.1    NWSH01003873    PCG65733.1    KQ460651    KPJ13003.1    KQ976413    KYM90403.1    GECZ01016812    JAS52957.1    PCG65731.1    AGBW02007651    OWR55047.1    KQ414860    KOC60060.1    KQ980612    KYN15123.1    ODYU01002244    SOQ39469.1    JR039355    AEY58654.1    JR039354    AEY58653.1    KZ288193    PBC34021.1    DS231997    EDS30986.1    PYGN01001841    PSN32561.1   
Pfam
PF02801   Ketoacyl-synt_C        + More
PF00698   Acyl_transf_1
PF16197   KAsynt_C_assoc
PF00109   ketoacyl-synt
PF00107   ADH_zinc_N
PF08659   KR
PF14765   PS-DH
PF00975   Thioesterase
PF00550   PP-binding
Interpro
IPR020801   PKS_acyl_transferase        + More
IPR014030   Ketoacyl_synth_N       
IPR016039   Thiolase-like       
IPR001227   Ac_transferase_dom_sf       
IPR020841   PKS_Beta-ketoAc_synthase_dom       
IPR016035   Acyl_Trfase/lysoPLipase       
IPR014031   Ketoacyl_synth_C       
IPR016036   Malonyl_transacylase_ACP-bd       
IPR014043   Acyl_transferase       
IPR032821   KAsynt_C_assoc       
IPR036291   NAD(P)-bd_dom_sf       
IPR011032   GroES-like_sf       
IPR042104   PKS_dehydratase_sf       
IPR023102   Fatty_acid_synthase_dom_2       
IPR029058   AB_hydrolase       
IPR020843   PKS_ER       
IPR013149   ADH_C       
IPR013968   PKS_KR       
IPR020807   PKS_dehydratase       
IPR001031   Thioesterase       
IPR018201   Ketoacyl_synth_AS       
IPR036736   ACP-like_sf       
IPR009081   PP-bd_ACP       
IPR020806   PKS_PP-bd       
SUPFAM
SSF53901   SSF53901        + More
SSF52151   SSF52151       
SSF55048   SSF55048       
SSF53474   SSF53474       
SSF51735   SSF51735       
SSF50129   SSF50129       
SSF47336   SSF47336       
PDB
3HHD     E-value=3.65289e-62,     Score=603

Ontologies

Topology

Length:
355
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
11.26493
Exp number, first 60 AAs:
2.29141
Total prob of N-in:
0.41213
outside
1  -  355
 
 

Population Genetic Test Statistics

Pi
21.104811
Theta
15.466258
Tajima's D
0.775368
CLR
0.650636
CSRT
0.611219439028049
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号