SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09848
Pre Gene Modal
BGIBMGA013280
Annotation
PREDICTED:_uncharacterized_protein_LOC105841877?_partial_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.122
 

Sequence

CDS
ATGACCACTCTACAAGATTTGGCTGCTGGAAGTGACAATATAAAATTAATTAAGGAATTTTTACGTCTGAAATATCACGTTTGTATTTCGGAACACAACGTTTTGAAGTTAAATAAACAAAAACTTCGTGAGATAGATTTTCTTGCAAACAACTTTGAGCACAAACAAGGTTTGGCTGTTTACTTCTCTCACATAGCTGAAGATGAACTCAGCTCCGATACTCCTATATATTTATTGCCTACTCTTGGTAATGCAAATGCGGAAAAACAGGTCGATGCACTGAAGTCTGAGTACTTGTGCGTTGTTCCTGGGATTGAAGGTCATCACGTAAGATTTCGTGGTCTCTGTGAGAGACTCAAACTGCCCGCGCTGGTGCTGCAGCCAAGTTTGAATGTGTTGCACGAAACCATAGAACAGGCTGCTCAAAGCTACTCTAAGATACTCATGGAAAAAATTGGTGTCGGTAACAATTTCTACTTGCTTGGGTGTGATATTGGAATTTTGATTGCGATGGAACTAGCTGCAATACTTGAGAGAAATGGTTTTTTGGGCACCATATTTTGTCTCGGAACTACACCAGAAGACGTCAAGCCAGTAATTGAACAACAACTAGGGGCGTTCTCAACAGAAGACCAACTGCAGCTTGGAATTTTAAAACATATTTTTACGCTACTAACTGGTGAAGTACCATCAGATTTAGATGAAACTCTGGACCCTCACTCTTCATGGAATGAAAAAATTGACGCTTGTATCAAAATGATGGCCGGTCGTATAACACAAACAAAGCAATATGTGAAAGCGTTAATAAATTTCGTCTATGAAAGAATTCTTAGCATCAAACAGTATGAATCCTCATCTTTGCCAATACTGAAGTCTAGAGTCGTGATACTCCGCTCCCCAGGATATTCGTCAACTTCATCTGCATCATCATACGTAATTGAAGATATATCAGCACCACTTTGTGATGCTGCAAAAGATGTGTGA
Protein
MTTLQDLAAGSDNIKLIKEFLRLKYHVCISEHNVLKLNKQKLREIDFLANNFEHKQGLAVYFSHIAEDELSSDTPIYLLPTLGNANAEKQVDALKSEYLCVVPGIEGHHVRFRGLCERLKLPALVLQPSLNVLHETIEQAAQSYSKILMEKIGVGNNFYLLGCDIGILIAMELAAILERNGFLGTIFCLGTTPEDVKPVIEQQLGAFSTEDQLQLGILKHIFTLLTGEVPSDLDETLDPHSSWNEKIDACIKMMAGRITQTKQYVKALINFVYERILSIKQYESSSLPILKSRVVILRSPGYSSTSSASSYVIEDISAPLCDAAKDV

Summary

EMBL
BABH01022926    BABH01022927    BABH01022928    BABH01022891    NWSH01000156    PCG78964.1    + More
JTDY01003650    KOB69211.1    BABH01041756    PCG78967.1    PCG78966.1    KQ461178    KPJ07769.1    PCG78965.1    BABH01022901    BABH01022902    JTDY01012055    KOB52337.1    KP237907    AKD01760.1    JTDY01003263    KOB69848.1    KQ459602    KPI93194.1    RSAL01000013    RVE53441.1    RSAL01000223    RVE44002.1    AGBW02013713    OWR42929.1    JTDY01003335    KOB69710.1    JTDY01000426    KOB77241.1    JTDY01002859    KOB70590.1    GEYN01000117    JAV02012.1    RVE53445.1    RSAL01000008    RVE53970.1    RSAL01000068    RVE49259.1    PCG78963.1    ODYU01012325    SOQ58579.1    NWSH01000591    PCG75471.1    U67866    AAB53257.1    PCG75470.1    RVE53971.1    BABH01033637    ODYU01001294    SOQ37311.1    JTDY01002311    KOB71689.1    JTDY01000529    KOB76788.1    KOB76790.1    BABH01033612    BABH01033613    PCG75472.1    KQ459053    KPJ04122.1    BABH01003987    BABH01003988    U67867    AAB53258.1    KPJ04123.1    NWSH01003873    PCG65731.1    NEVH01025646    PNF15228.1    PNF15226.1    ODYU01010623    SOQ55856.1    GL438820    EFN68400.1    AGBW02007651    OWR55047.1    GL451785    EFN78551.1    ODYU01002245    SOQ39471.1    ABLF02036897    GEDC01024813    JAS12485.1    NNAY01001760    OXU23005.1    LBMM01018330    KMQ83820.1    CVRI01000051    CRK99509.1    GL765755    EFZ15969.1    GGMR01004548    MBY17167.1    GBYB01001605    JAG71372.1    KM507100    AKM28424.1    GECZ01008485    JAS61284.1    KQ761246    OAD57941.1    GL435066    EFN74070.1    OXU23002.1    NEVH01022635    PNF18738.1    GL449898    EFN81866.1    GEBQ01031053    JAT08924.1    KQ976440    KYM86527.1    KQ982480    KYQ55999.1    GGMS01017661    MBY86864.1    GECU01006695    JAT01012.1    AK403251    BAM19658.1    ADTU01005072    ADTU01005073    ADTU01005074    ADTU01005075    GL888175    EGI66082.1    GBYB01001820    JAG71587.1    GL445739    EFN89136.1    DS231997    EDS30986.1    AJWK01021412    GL438338    EFN69128.1   
Pfam
PF00975   Thioesterase        + More
PF02801   Ketoacyl-synt_C
PF00109   ketoacyl-synt
PF00698   Acyl_transf_1
PF16197   KAsynt_C_assoc
PF14765   PS-DH
PF08659   KR
PF00107   ADH_zinc_N
PF00550   PP-binding
Interpro
IPR029058   AB_hydrolase        + More
IPR042104   PKS_dehydratase_sf       
IPR023102   Fatty_acid_synthase_dom_2       
IPR001031   Thioesterase       
IPR032821   KAsynt_C_assoc       
IPR014043   Acyl_transferase       
IPR036291   NAD(P)-bd_dom_sf       
IPR016035   Acyl_Trfase/lysoPLipase       
IPR014031   Ketoacyl_synth_C       
IPR020841   PKS_Beta-ketoAc_synthase_dom       
IPR001227   Ac_transferase_dom_sf       
IPR020843   PKS_ER       
IPR014030   Ketoacyl_synth_N       
IPR016039   Thiolase-like       
IPR020801   PKS_acyl_transferase       
IPR011032   GroES-like_sf       
IPR016036   Malonyl_transacylase_ACP-bd       
IPR020807   PKS_dehydratase       
IPR013968   PKS_KR       
IPR013149   ADH_C       
IPR036736   ACP-like_sf       
IPR018201   Ketoacyl_synth_AS       
IPR020806   PKS_PP-bd       
IPR009081   PP-bd_ACP       
IPR006162   Ppantetheine_attach_site       
IPR000999   RNase_III_dom       
IPR036389   RNase_III_sf       
SUPFAM
SSF53474   SSF53474        + More
SSF53901   SSF53901       
SSF52151   SSF52151       
SSF51735   SSF51735       
SSF50129   SSF50129       
SSF55048   SSF55048       
SSF47336   SSF47336       
SSF69065   SSF69065       

Ontologies

Topology

Length:
327
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
9.02036999999997
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.40065
outside
1  -  327
 
 

Population Genetic Test Statistics

Pi
115.545845
Theta
166.663522
Tajima's D
-1.001776
CLR
243.892261
CSRT
0.140242987850607
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号