SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09839
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Integrin beta       + More
Guanylate cyclase      
Location in the cell
Cytoplasmic   Reliability : 1.776 Nuclear   Reliability : 1.087
 

Sequence

CDS
ATGTCAGTCCGAGTACAGGAGCATTGCACGAAGGAAATCCCTGTAAAGAGAGGAGTGAGACAGGGAGATGTGATATCTCCGAAACTGTTTATCACTGCTCTGGAGGATTCCTTCAAGCTTCTGGAATGGCAAGGACTTGGCATCAATATTAACGGCGAATACATCACTCATCTTCGGTTTGCCGATGACATCGTGGTCATGGCAGAGTCGCTGGAAGATTTAGGGCGTATGCTCGGTGACCTCAGTAGGGTTTCTCAACAAGTGGGTCTTAAAATGAACATGGACAAAACAAAAATCATGTACAATGTCCATGTTGCACCCACCATAGTTACTGTTGGGAGCTCTACTCTTGAAGTTGTTGACGAATATATATACCTAGGACAGGCAGTCCGATTAGCTAGGTCCAACTTTGAGAGAGAGGTCAGTAGACGGATCCAACTCGGCTGGGCAGCGTTCGGTAAACTGCACAACGTCTTCTCGTCCAAAATACCTCAGTGCCTTAAGACAAAGGTGTACAACCAATGTGTGTTACCAGTGATGACTTACGGCTCGGAGACGTGGTGCTTCACTAGGGATCTTTTTAGAAGGCTCAAAGTCGCGCAGCGAGCTATGGAGAGGGCTATGCTCGGCATTTCTCTACGTGATCGAATCTGA
Protein
MSVRVQEHCTKEIPVKRGVRQGDVISPKLFITALEDSFKLLEWQGLGININGEYITHLRFADDIVVMAESLEDLGRMLGDLSRVSQQVGLKMNMDKTKIMYNVHVAPTIVTVGSSTLEVVDEYIYLGQAVRLARSNFEREVSRRIQLGWAAFGKLHNVFSSKIPQCLKTKVYNQCVLPVMTYGSETWCFTRDLFRRLKVAQRAMERAMLGISLRDRI

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
Similarity
Belongs to the integrin beta chain family.
Belongs to the ATP-dependent DNA ligase family.
Feature
chain  Integrin beta
EC Number
4.6.1.2
EMBL
FJ265543    ADI61811.1    FJ265544    ADI61812.1    KZ150072    PZC74016.1    + More
EF113399    EF113400    ABO45233.1    EF113398    EF113401    ABO45231.1    EF113402    ABO45239.1    RSAL01002362    RVE40503.1    FJ265549    ADI61817.1    RSAL01000057    RVE49824.1    RSAL01000344    RVE42347.1    FJ265542    ADI61810.1    RSAL01002130    RVE40575.1    RSAL01000007    RVE54059.1    FJ265550    ADI61818.1    GAIX01012906    JAA79654.1    FJ265551    ADI61819.1    FJ265545    ADI61813.1    GBBM01001358    JAC34060.1    MRZV01000717    PIK45367.1    GFAC01005640    JAT93548.1    MRZV01002136    PIK34564.1    AAGJ04144474    RSAL01003575    RVE40262.1    MRZV01000640    PIK46507.1    RSAL01000016    RVE53061.1    AGCU01063447    GFAA01001426    JAU02009.1    MRZV01000899    PIK42833.1    KZ149985    PZC75698.1    AAGJ04050748    KZ149912    PZC78089.1    KZ150108    PZC73382.1    RSAL01002495    RVE40475.1    JARK01001359    EYC20046.1    JARK01001639    EYB85201.1    JARK01001389    EYC11015.1    JARK01000055    EYC44622.1    EYC44623.1    ODYU01004982    SOQ45402.1    JARK01001568    EYB89432.1    GBGD01000453    JAC88436.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    JARK01000807    EYC34984.1    FJ265562    ADI61830.1    FJ265561    ADI61829.1    KZ150485    PZC70710.1    JARK01001424    EYC04315.1    EYC04316.1    KZ150317    PZC71439.1    EYC04317.1    EYC04314.1    GBBI01004877    JAC13835.1    JARK01001396    EYC09581.1    GBBI01004876    JAC13836.1    ODYU01004088    SOQ43598.1    JARK01001473    EYB97806.1    JARK01001348    EYC25048.1    EYC25050.1    GDKW01001596    JAI54999.1    GFTR01005437    JAW10989.1    EYC25049.1    EYC25046.1    JARK01001372    EYC15592.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01001434    EYC02684.1    EYB98997.1    KZ149907    PZC78256.1    UYRV01017460    VDK63226.1    JARK01000347    EYC38051.1    JARK01001351    EYC23394.1    JARK01001512    EYB94036.1    JARK01000460    EYC36749.1    JARK01001621    EYB86109.1    JPKZ01000640    KHN86200.1    JARK01001340    EYC30828.1    JARK01001626    EYB85833.1    JARK01001370    EYC16151.1    EYB98944.1    EYC31295.1    EYC23395.1    JARK01001677    EYB83168.1    LN609407    CEF61413.1    EYB83167.1    UZAG01000503    VDO08661.1    JARK01000173    EYC41342.1    JARK01001655    EYB84321.1    FJ265563    ADI61831.1    JARK01001362    EYC18844.1    EYC18843.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00362   Integrin_beta
PF01826   TIL
PF11411   DNA_ligase_IV
PF04675   DNA_ligase_A_N
PF04679   DNA_ligase_A_C
PF01068   DNA_ligase_A_M
PF13855   LRR_8
PF00071   Ras
PF01549   ShK
PF01094   ANF_receptor
PF07714   Pkinase_Tyr
PF00211   Guanylate_cyc
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR032695   Integrin_dom_sf       
IPR036465   vWFA_dom_sf       
IPR015812   Integrin_bsu       
IPR002035   VWF_A       
IPR002369   Integrin_bsu_VWA       
IPR011993   PH-like_dom_sf       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
IPR001357   BRCT_dom       
IPR036420   BRCT_dom_sf       
IPR012340   NA-bd_OB-fold       
IPR016059   DNA_ligase_ATP-dep_CS       
IPR012310   DNA_ligase_ATP-dep_cent       
IPR021536   DNA_ligase_IV_dom       
IPR029710   LIG4       
IPR000977   DNA_ligase_ATP-dep       
IPR012308   DNA_ligase_ATP-dep_N       
IPR036599   DNA_ligase_N_sf       
IPR012309   DNA_ligase_ATP-dep_C       
IPR032675   LRR_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR005225   Small_GTP-bd_dom       
IPR025662   Sigma_54_int_dom_ATP-bd_1       
IPR027417   P-loop_NTPase       
IPR001806   Small_GTPase       
IPR003582   ShKT_dom       
IPR001828   ANF_lig-bd_rcpt       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR011009   Kinase-like_dom_sf       
IPR001170   ANPR/GUC       
IPR001054   A/G_cyclase       
IPR028082   Peripla_BP_I       
IPR000719   Prot_kinase_dom       
IPR029787   Nucleotide_cyclase       
IPR029052   Metallo-depent_PP-like       
SUPFAM
SSF56219   SSF56219        + More
SSF53300   SSF53300       
SSF69179   SSF69179       
SSF57567   SSF57567       
SSF52113   SSF52113       
SSF50249   SSF50249       
SSF52540   SSF52540       
SSF53822   SSF53822       
SSF55073   SSF55073       
SSF56112   SSF56112       
PDB
5HHL     E-value=0.000468875,     Score=100

Ontologies

Topology

Subcellular location
Membrane  
Length:
217
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.41737
Exp number, first 60 AAs:
0.00094
Total prob of N-in:
0.28092
outside
1  -  217
 
 

Population Genetic Test Statistics

Pi
209.591113
Theta
133.543426
Tajima's D
2.9978
CLR
13.956336
CSRT
0.980150992450378
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号