SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09806
Pre Gene Modal
BGIBMGA013147
Annotation
PREDICTED:_MOG_interacting_and_ectopic_P-granules_protein_1-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 4.691
 

Sequence

CDS
ATGTCGATTTCTACTGCTACAGATGAACGCACAGAAGGTGATGATGACACCTCACAAGGAAGCCACCCAAAAGAAGACAGTAGTGACTCTGAAAATGAGACTGAGCCTCAAAATCAAAATGGAGGCTCTCCCGCACCAGAAGTTCATGAAATTACTAGTGATGATGATGAGGAAGAGGGGGGTGTAACAAATGAAGATGATTCCTCCAACTCAAGTACAGTAAGTAATGATAGTTCAGAAGGATCCCAACACAGTAGTAAGGAAACAGAGAAGAAAGACATTGAACATTTAGAAGAGAATGGTGCTGATGAGTCTGATATTGAAGAAATTGCTATGGAGGATCCATTAAACCAAACACAAAGCATTAACAAACCTATTGTGATAAATGATACAAAGTGTTTGGTCAACTTAGCTTCTAAACAGACTAAACCAAATGGGGATCAGAATAAAGAGCCTACAGTTGTTATTATTGATACAAATTCAATACTTGCTGGCAAAGGGCCTCTCCCGTTGCAAAGCAAAATGCATACAACTACTACTACTAGTATGATGGATCAACAGGACTTGTGCCAAAGCATTGCTGCTCGGGGCACTACTATCACACCAGTTAGTAATAAGACTGCAAATCAGAACAGTGCTCATAATAGTACTCCTGCAGCTCCACCTCCCAACATACTGCCATCTCTCACAGATGATATGTTTGTTGTTGAAGCACCATCCTTCATTGTTCCATATGTTTATGAGAAACCTTCTCTAAAGCCTTTTAGAGAATTTGTGGACAAGCTTGGTAAAGAGCTTGAAGAACTCAAAATTAAAGAAGAACAGGAAAAAGCAGAGAAGGAAAAGATTGAGAGGGAAAGGAGAGATAAAGAGAGGAAGGAAAGAATTGAAAGAGGAGAAATAGAGGAAGATGATGAGGTTAAGGAGTCCAGAAAACTAGAAGTTGCACAAAAGAAAGAGAAAAAACAAGGATGGAAACGCACTGATGATGATGATGATGATTCTTGGGACGGTGAATCATCCTCTGAGTCAGAGGAAGAAGCTCTCAGTGATGATGATGCTGTAGTAATTAAAGAAAAAGAGGACAGTGACACCACCGACCCAATCAGCCTTATTGCCAAAAGCCTTTCAAGTGGAAAGCCAGACAGTTACTTTGATTGTTCATTAGGACAATTTTTTATTAACATTGGACTGAATTTAGTGCAAGAGTATGTTCAAACTGATTTATTAAAGCAACAACAGCGCAAGCTCTATAAAGAGAAGAAATCAGGACGCAGTACCAAGTCAACGGAGGCTGCAATTGCATCTTTGTCTCAGAACTTAGATTTCAGCAAGAAAACAAATGCACCATTTGCTCTTTCACACAGAAGGTGTGATTTTTGTAGTTTTAAAACTGAATCTATGTTAGTTATGGCTCATCACCTTGAAGCACCTCACATGAGAAGTAACATATACAAGTGTAATTCATGTGAGTTTGAAATACGAAGTCCTCATGATATATTGTTCCATATGGAGGCAGAACACAATATTAGGGGCAGATTGGAACGGGCTCCTGCATACCAGCAATGTGCTAACTGTCATTTTGAAGACAACAGTAAAACAAAACTGGCTCGACATTTGATTGCTTGTGCTAAAAAATTCAAGCCAGAATTTAACTTAGGACCTCCTCTAGAATGGGAACCCCCAGCAAAAATACCAAAGTTAACCAGAGCACGCAATAATATGATGAGTTCTTACCAATCAAATTATAATAGACCTAATATGAATAACATGGGCAGGCCTCAATTGAACATTACAAATGCCTTGCCTAATATGCCCATGTTGGGAAGACCGCGAGGTCGTCCTCCCCTTTCAGGTCCACCACGTCCTTCTGCTGTGTCAGGAATGCCAATAATAAGGAGTGGTGTCATGATTATGCATAATACTCCACCTGGAACGACAATCTCCAACTATCCAATCGTAAATAATCAAAGCAATGCACCTGCCGCCCCTAAAATATCAATCACTCCTTTACCTCGAGCCCCACAGCCTTCTTCCTCACAATCAGCTCACAATTCTAAAGCCACTTTTGTCATCTGCGAAATATGTGATGGTTATATTAAAGACTTAGAGCAGCTAAGGAACCACATGCAGTGGATACACAAAGTGAAAATACACCCTAAGATGATATATAACAGGCCACCATTGAACTGTCAAAAATGTCAATTTAGGTTTTTTACAGATCAAGGCTTAGAGAGGCACCTCCTTGGTTCCCATGGTTTGGTAACAAGTTCAATGCAAGAAGCAGCAAACAAGGGTAAGGATGCAGGTAGGTGTCCCGTGTGTGGCAGAGTGTATCAGTGGAAACTCCTTAATCATGTGTCAAGGGATCACAACATGACACTGAAACCAGCCCATTTATCGTACAAATGCACGGTGTGTACTGCCACTTTTGGTATGTATAAGCAGTTTGAGAATCATGTATATTCGGCTCACAGCGTCGTAGCCAAACGTGTTATGGACAAGACTAAGACTACTACTCCTGCAAGCAAACCTGCTGACTCTGAATCACTTCTTAAACCCTTAAAAATTAGTGATGAGATCACAATCATACCGCAGCCTGCAAAGTCATCACTAACTATTACTGCTAAGGGTAAATAA
Protein
MSISTATDERTEGDDDTSQGSHPKEDSSDSENETEPQNQNGGSPAPEVHEITSDDDEEEGGVTNEDDSSNSSTVSNDSSEGSQHSSKETEKKDIEHLEENGADESDIEEIAMEDPLNQTQSINKPIVINDTKCLVNLASKQTKPNGDQNKEPTVVIIDTNSILAGKGPLPLQSKMHTTTTTSMMDQQDLCQSIAARGTTITPVSNKTANQNSAHNSTPAAPPPNILPSLTDDMFVVEAPSFIVPYVYEKPSLKPFREFVDKLGKELEELKIKEEQEKAEKEKIERERRDKERKERIERGEIEEDDEVKESRKLEVAQKKEKKQGWKRTDDDDDDSWDGESSSESEEEALSDDDAVVIKEKEDSDTTDPISLIAKSLSSGKPDSYFDCSLGQFFINIGLNLVQEYVQTDLLKQQQRKLYKEKKSGRSTKSTEAAIASLSQNLDFSKKTNAPFALSHRRCDFCSFKTESMLVMAHHLEAPHMRSNIYKCNSCEFEIRSPHDILFHMEAEHNIRGRLERAPAYQQCANCHFEDNSKTKLARHLIACAKKFKPEFNLGPPLEWEPPAKIPKLTRARNNMMSSYQSNYNRPNMNNMGRPQLNITNALPNMPMLGRPRGRPPLSGPPRPSAVSGMPIIRSGVMIMHNTPPGTTISNYPIVNNQSNAPAAPKISITPLPRAPQPSSSQSAHNSKATFVICEICDGYIKDLEQLRNHMQWIHKVKIHPKMIYNRPPLNCQKCQFRFFTDQGLERHLLGSHGLVTSSMQEAANKGKDAGRCPVCGRVYQWKLLNHVSRDHNMTLKPAHLSYKCTVCTATFGMYKQFENHVYSAHSVVAKRVMDKTKTTTPASKPADSESLLKPLKISDEITIIPQPAKSSLTITAKGK

Summary

Uniprot
Interpro
IPR013087   Znf_C2H2_type       
ProteinModelPortal

Ontologies

Topology

Length:
879
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000970000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00008
outside
1  -  879
 
 

Population Genetic Test Statistics

Pi
16.36921
Theta
13.351641
Tajima's D
0.111784
CLR
184.819309
CSRT
0.409029548522574
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号