SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09804  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA013115
Annotation
phenoloxidase_subunit_2_precursor_[Bombyx_mori]
Full name
Phenoloxidase subunit 2       + More
Phenoloxidase 1      
Phenoloxidase subunit 1      
Phenoloxidase 2      
Alternative Name
PO 2
Tyrosinase 2
proPO-p2
Prophenoloxidase-I
PO 1
Tyrosinase 1
proPO-P1
Phenoloxidase subunit A3
Processed phenoloxidase A3
Location in the cell
Nuclear   Reliability : 2.165
 

Sequence

CDS
ATGGCTGACGTTTTTGAAAGCCTCGAGTTGCTGTTCGATCGTCCAAATGAGCCGCTCATCACACCCAAGGGCGAAAACAATTCTGTGTTTCAACTCACAGAACAATTTTTGACTGAGGACTACGCCAACAACGGCATCGAATTAAACAACCGTTTCGGTGACGATGCTTCTGAGAAGATACCCCTCAAGAACCTCAGCAAACTCCCAGAATTTAAAATTGCAACTCAACTACCCAAGGACGCTGAATTCTCATTGTTTCTACCTAAACATCAAGAAATGGCAAATGAACTTCTTGGCGTTCTCATGGATGTACCAGAGAACGAATTACAAGATTTGCTATCGACATGCGCCTTTGCACGAGTAAACCTGAACCCTCAGTTGTTCAACTATTGTTACTCTGTGGCACTGATGCACAGACGTGATACCAGAAAAGTCAGAGTTAAGAATTTTGCAGAAGTATTTCCCTCTAAATTCTTGGATTCCCAAGTATTCACTCAGGCTCGTGAAACTGCAGCCGTTATTCCACCAGATGTTCCACGCATACCTATTATCATTCCACGAGACTACACTGCGACGGACTTAGAAGAAGAACACCGCCTTGCGTACTGGCGAGAAGATATCGGCATCAACCTGCATCATTATCACTGGCATTTGGTCTACCCGTTTACGGCCAACGATCTTTCAATCGTAGCTAAGGACCGTCGTGGGGAGTTGTTCTTCTATATGCACCAGCAAGTGATAGCCCGCTTCAACTGCGAGCGCTTGTGCAATTCATTAAAAAGAGTTAAAAAATTCAGCAACTGGAGGGAGCCAATTCCAGAGGCTTACTTCCCTAAGCTTGACAGTTTGACTTCGTCGCGCGGATGGCCGCCGCGTCAGTCCGGTATGCAATGGCAGGACCTGAATCGTGCGGCCGAAGGTCTATTTGTGACCATTGACGAAATGGAACGCTGGAGAAGAAACGTTGAAGAAGCTATCGCGACTGGTACCGTTAGATTGCCAAACGGGCAGACTCGGCCTCTTGACATCGATACGCTCGGCAACATGTTGGAGTCCAGCGCCCTCTCGCCGAACAGAGAACTGTACGGTTCGATACACAACAACGGGCACAGTTTCACCGCGTACATGCACGACCCGGAACACAGATACCTTGAACAATTTGGTGTTATCGCTGATGAGGCCACAACGATGCGCGATCCATTCTTCTACCGCTGGCACGCCTACATCGATGACGTTTTCCAGAAGCACAAGGAATCTGCCTACGTGCGTCCTTACACTCGATCTGAGCTCGAGAACCCGGGCGTGCAAGTGAGGTCCGTGTCGGTGGAGACGCCCGGCGGACAACCGAACACGCTGAACACGTTCTGGATGCTCAGCGACGTGAACTTGTCGCGCGGACTCGACTTCTCCGACAACGGGCCCGTGTACGCTCGCTTCACTCACCTCAACTACAGGCATTTCAGCTACAGAATAAACGTGAACAACACCGGTAGCAGCCGTCGCACCACAGTGCGTATCTTCATCACTCCGAAGTTCGACGAGCGCAATGTCCCCTGGATATTCTCGGACCAACGCAAGATGTGTATTGAAATGGACAGATTCGTCACTGTCCTGAACGCCGGAGAGAATAATATTGTCCGTCAGTCGACGGAGTCTTCCATAACTATTCCGTTCGAACAGACATTCCGCGACCTATCCGCTCAGGGCAATGATCCACGACGCGACGAACTCGCTACCTTCAATTACTGCGGCTGCGGCTGGCCTCAGCACATGCTCGTGCCCAAGGGCACTGAAGCCGGCATGCCCTTCCAACTGTTTGTTATGTTATCCAACTATGATTTAGACCGGATCGATCAAGATGACGGAAAACAGCTCACTTGTGTGGAAGCGTCGAGCTTCTGTGGATTAAAGGATAAGAAATATCCTGATAGGCGCGCTATGGGATTCCCGTTCGATCGACCCTCGAGCAGCGCCACCAGCCTCCAGGACTTCATTTTACCAAACATGGGCTTGCAGGACATCACTATTCAATTGCAAAACGTCACCGAACCTAACCCACGGAACCCTCCCATGTCTGTTTAA
Protein
MADVFESLELLFDRPNEPLITPKGENNSVFQLTEQFLTEDYANNGIELNNRFGDDASEKIPLKNLSKLPEFKIATQLPKDAEFSLFLPKHQEMANELLGVLMDVPENELQDLLSTCAFARVNLNPQLFNYCYSVALMHRRDTRKVRVKNFAEVFPSKFLDSQVFTQARETAAVIPPDVPRIPIIIPRDYTATDLEEEHRLAYWREDIGINLHHYHWHLVYPFTANDLSIVAKDRRGELFFYMHQQVIARFNCERLCNSLKRVKKFSNWREPIPEAYFPKLDSLTSSRGWPPRQSGMQWQDLNRAAEGLFVTIDEMERWRRNVEEAIATGTVRLPNGQTRPLDIDTLGNMLESSALSPNRELYGSIHNNGHSFTAYMHDPEHRYLEQFGVIADEATTMRDPFFYRWHAYIDDVFQKHKESAYVRPYTRSELENPGVQVRSVSVETPGGQPNTLNTFWMLSDVNLSRGLDFSDNGPVYARFTHLNYRHFSYRINVNNTGSSRRTTVRIFITPKFDERNVPWIFSDQRKMCIEMDRFVTVLNAGENNIVRQSTESSITIPFEQTFRDLSAQGNDPRRDELATFNYCGCGWPQHMLVPKGTEAGMPFQLFVMLSNYDLDRIDQDDGKQLTCVEASSFCGLKDKKYPDRRAMGFPFDRPSSSATSLQDFILPNMGLQDITIQLQNVTEPNPRNPPMSV

Summary

Description
This is a copper-containing oxidase that functions in the formation of pigments such as melanins and other polyphenolic compounds. Catalyzes the rate-limiting conversions of tyrosine to DOPA, DOPA to DOPA-quinone and possibly 5,6 dihydroxyindole to indole-5'6 quinone. Binds to the surface of hemocytes and is involved in hemocyte melanization.
This is a copper-containing oxidase that functions in the formation of pigments such as melanins and other polyphenolic compounds. Catalyzes the oxidation of o-diphenols (N-acetyldopamine, 4-methylcatechol and dopamine). Cannot oxidize monophenols and p-phenols (L-tyrosine, tyramine, gentisic acid and hydroquinone). Binds to the surface of hemocytes and is involved in hemocyte melanization. Activation of the enzyme in response to bacterial lipopolysaccharides (LPS) suggests it may play a role in innate immunity.
This is a copper-containing oxidase that functions in the formation of pigments such as melanins and other polyphenolic compounds. Catalyzes the rate-limiting conversions of tyrosine to DOPA, DOPA to DOPA-quinone and possibly 5,6 dihydroxyindole to indole-5'6 quinonee (By similarity).
Catalytic Activity
2 L-dopa + O2 = 2 H2O + 2 L-dopaquinone
L-tyrosine + O2 = H2O + L-dopaquinone
Cofactor
Cu(2+)
Subunit
Heterodimer.
Heterodimer. Forms a complex with an interleukin 1-like protein as a consequence of a host defense response.
Dimer (PubMed:9085271). Might form a homodimer or a heterodimer with PPO1 (PubMed:9085271). Might interact with PPAF2 (via CLIP domain); the interaction might be required for PPO1 activity (PubMed:16362048).
Similarity
Belongs to the tyrosinase family.
Keywords
Complete proteome   Copper   Direct protein sequencing   Disulfide bond   Glycoprotein   Melanin biosynthesis   Metal-binding   Monooxygenase   Oxidoreductase   Reference proteome   Secreted   Zymogen   3D-structure   Immunity   Innate immunity  
Feature
chain  Phenoloxidase subunit 2
propeptide  Removed by PPAF1
EC Number
1.14.18.1
1.14.18.-
EMBL
D49371    AB048762    BAB41101.1    EU047703    ABW06580.1    AB048761    + More
BAB40959.1    AF178461    AAG09303.1    EF684939    ABS59653.1    EF044308    NWSH01000035    ABM65701.1    PCG80455.1    DQ114946    EF614331    KY744278    AAZ52554.1    ABU98653.1    ATD13327.1    DQ289582    ABB92835.1    RSAL01000051    RVE50242.1    GU953227    ADF43211.1    AB778569    BAM76812.1    AY703825    AAW22859.1    AM293328    CAL25133.1    L42556    AAC37243.1    KT006135    ANH58160.1    GQ149238    ACS36209.1    GU214207    ADA60207.1    AY371489    AAQ75026.1    DQ333883    ABC59699.2    KQ458756    KPJ05239.1    EU046573    ABW16862.1    AK401408    BAM18030.1    GDQN01004074    JAT86980.1    HM210573    ADM53096.1    AF020391    AAC34256.1    HM235814    ADK11055.1    AGBW02008320    OWR53745.1    OWR53744.1    KX437621    AQM36766.1    GDQN01007653    JAT83401.1    AY884063    KQ971312    AAX84204.1    EEZ99189.1    JRES01000975    KNC26576.1    DQ289581    ABB92834.1    AY494738    AAR84669.1    CVRI01000070    CRL07388.1    AB778568    BAM76811.1    KP974690    ALE19971.1    JX987234    AGC54939.1    JX987235    AGC54940.1    JX110850    AFP81886.1    DQ841706    NWSH01000045    ABH10016.2    PCG80267.1    AB079665    BAC15603.1    KY744277    ATD13326.1    KQ971348    KYB26937.1    AY884064    AAX84205.1    AB020738    BAA75470.1    JXJN01019700    GBXI01017411    JAC96880.1    GAMC01009964    GAMC01009963    JAB96591.1    EFA05662.1    D49370    BAA08368.1    EU569724    ACC69184.1    BABH01004244    BABH01004245    KNC26607.1    AF161260    AAD45526.1    HM776513    ADL14486.1    HM026570    ADG65539.1    GDHF01026318    JAI25996.1    GAKP01021407    JAC37545.1    KR181955    ALJ76679.1    AF003253    AAC05796.1    GDHF01011142    JAI41172.1    AF178462    AAG09304.1    CCAG010007845    AY665397    AAU29555.1    JF342362    AEA92682.1    CM000157    EDW89439.1    JX844653    JX844654    AFU83105.1    CM002911    KMY92407.1    AE013599    AY060652    AB055857    CH480816    EDW47034.1    AY242387    AAO72539.2    CH954177    EDV59434.1    KNC26577.1    KK107139    QOIP01000003    EZA57912.1    RLU24656.1    GL446009    EFN88581.1    KZ288308    PBC28707.1    KQ977580    KYN01776.1    OUUW01000001    SPP74446.1    GBYB01001048    JAG70815.1    KQ459582    KPI98957.1    APGK01024671    KB740558    ENN80355.1    GEBQ01000915    JAT39062.1    GEBQ01004626    JAT35351.1    KB632357    ERL93468.1   
Pfam
PF00372   Hemocyanin_M        + More
PF03722   Hemocyanin_N
PF03723   Hemocyanin_C
PF01401   Peptidase_M2
Interpro
IPR013788   Hemocyanin/hexamerin        + More
IPR008922   Unchr_di-copper_centre       
IPR037020   Hemocyanin_C_sf       
IPR014756   Ig_E-set       
IPR005204   Hemocyanin_N       
IPR002227   Tyrosinase_Cu-bd       
IPR000896   Hemocyanin/hexamerin_mid_dom       
IPR005203   Hemocyanin_C       
IPR036697   Hemocyanin_N_sf       
IPR001548   Peptidase_M2       
SUPFAM
SSF81296   SSF81296        + More
SSF48050   SSF48050       
SSF48056   SSF48056       
PDB
3HHS     E-value=0,     Score=2834

Ontologies

Topology

Subcellular location
Secreted  
Length:
693
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000780000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00004
outside
1  -  693
 
 

Population Genetic Test Statistics

Pi
253.510415
Theta
194.289621
Tajima's D
1.114335
CLR
0.218157
CSRT
0.695565221738913
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28467696 EIYDAEQGISDPAEKR 95.65 7e-11
24402669 YIEQFGVIADEATTMR 95.45 6e-09
28467696 YIEQFGVIADEATTMR 95.45 6e-09
29197581 YIEQFGVIADEATTMR 95.45 6e-09
24402669 MCIEMDR 95.24 1e-08
28467696 MCIEMDR 95.24 1e-08
29197581 MCIEMDR 95.24 1e-08
24402669 KFSEGIKR 100.00 4e-05
29197581 IPNGQTRPIDIDTIGNMIESSAISPNR 100.00 4e-05
25044914 FSMYTPEIQER 100.00 2e-04
24402669 FSNAVEAR 100.00 2e-04
28467696 FSNQNQGIQSYR 100.00 2e-04
29197581 FIDSQVFTQAR 100.00 2e-04
26822097 GIDFSDNGPVYAR 100.00 0.001
26280517 KIYNSVITADYDDATKR 100.00 0.001
25044914 QSSSTAQIVHSIPSIIHR 100.00 0.001
24402669 QSSGSIIEDTVNNIIR 100.00 0.001
28467696 QSTAYAYINKK 100.00 0.001
29197581 QSGMQWQDINR 100.00 0.001
28556443 GYALVEYETYK 100.00 0.006
28556443 DLSAQGNDPR 100.00 0.006
26822097 NVPWIFSDQR 100.00 0.027
25044914 WHAYIDDIFHIYK 100.00 0.027
24402669 WHAYIDDIFHIYK 100.00 0.027
28467696 WHAYIDDIFHIYK 100.00 0.027
29197581 VKNFAEVFPSK 100.00 0.027
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号