SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09801
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.073
 

Sequence

CDS
ATGAGGCGTATAAAATCAAAGGCAGCTAAATCCAATATTCAGCGAAAGTGCAACGGGGAGGGGCTTCACATTCCGGCGAGGTCCAGAGATATTGTAATCGAGAAATACAATAGTGGTAGCTATAAAGGTCACTACAACCCGGTTACATTATCTTTGGACCTGGCGAAAGGTCAACGAGGAGGGGCTTCACATTCCAGCGAGGTCCAGAGATATTTCCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAATGCATTCTGGCAGCCCGCATCATCCAGCATCTGGTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGATATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGTCATAGAGTGCCCCCCTACCTTCGCCGGCTGTCCCTGGCCGTGGGGGTGGCGAAGCTGCGGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATAAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAATGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGAGTTCCTGCACCGGATCACAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCCTCGCAAAAATAGGAACCGACTTGCCGTTGCCGTGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCACCGTCGAGCGGGGGCCAGGGAGGTGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MRRIKSKAAKSNIQRKCNGEGLHIPARSRDIVIEKYNSGSYKGHYNPVTLSLDLAKGQRGGASHSSEVQRYFPIVLLDEVGKLLECILAARIIQHLVGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHRVPPYLRRLSLAVGVAKLRQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYKWRADLRARGVARPSPNVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRITAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLLAKIGTDLPLPCVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRHRRAGAREVDLAQALAL

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal

Ontologies

GO

Topology

Length:
414
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.807139999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.10395
outside
1  -  414
 
 

Population Genetic Test Statistics

Pi
271.060431
Theta
210.915057
Tajima's D
0.575838
CLR
414.539019
CSRT
0.540822958852057
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号