SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09780
Pre Gene Modal
BGIBMGA001112
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.545
 

Sequence

CDS
ATGGGAAGCGGGGGCTCCTGCCTTTACTGGTCGGAGCCGCGAGGACGCAAACCTCTTCAAAAATGCCCCAATCTCAAGCTCGACACCCGGCGATGGGATGTATGGCTGGAGGGTTTCCAGTCCCGAGGGTGTCGTAGATCCCAGGGGACCAAACCCCTGGTTAATAAAAAAGGAATAAATAGAAATGATGGACAATTGTACAAAGTTAGTACCCCAGGAGGGTACCGCCCGCGAGTCGGGCGGAGAATCCCTCCGTGCTTCCACCTCAGTGGAAGCACGCTGCCCCACGTATTCTGGGGGGGCAACAATTGCCAGGATGAAGGAGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACTGAGGCGCTCCCCGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGCGACTCGGGTGCGGTCAACCCCACCAGACCATCGGTGGGGAAAAAAAGGGGGCGAAGGAAGACCCCACTATCAACGTCCGACGACGGCGGCGCGTCATCCTCCAGCACCGAGGTGCCGGAAAAGACGATGGCCATCGAGGAGGTGGCTCCGGTGGTTGCGGGGCCTGCCGCAAAGAAAGAGACGATGCCCGCTCCCCAGTGGGCACCAGTAAGGAGGAGGGGCGCAGTGTCACCAGCGACGTCGGTGGAGTCGATGTCGACGTCGGCCGCGTCCCTGGCTAGCGGGGACGAGGCATTCCGCGACCTCGACCTTGCGCTGGTCAATCTGGCTAAGCTGCTGTCGACCGTGGCTGCCAAGGGCGCCGAGCCAGGCAGCAGCTACCGGAAAAGGCTCCGGGAGGGAGCGGCTATGGAACTCCCCCGTCTTGCAAGAGGGGACTCCCTTGTCGCCGATGCCTGCGCTGGCACACTCTGGGCCTCCCGCGAGGAAGATGGATACCAGCGTGCCCTCACGACCCGTGATGAGTGTGGCGGCGCCCATGCCAGCGCCTACTTCTGTGGCCCCTGTTCCACGAGTGCCTACTCCCGCGCTCCCTCACCCCCGCGGAGGGTTGAGTTGAGGCCTGCGCCGCCTCCCCAAATATCGGCCACCCCTGCATCCGTACAAAGAGGAAGGTTAAGGCCTGCGCCAGCGCAGGCTGAAGACATCCGTTCGCCACTGGCGAGGATGATAGACGAGTGGCCGGCGCTGCCGCGGCCCAGGCCTGCAGAGCCGCCAAGCAGAGAGGAAATGGCGGCCTGCATCTCGCGGGCGGTGGCGGTTGAGGTCCGCAAACACTTTGCCGGCCTCGAGGAGATGCTCCGCTCCTCGATTGGTTCCGGAGATGGCGTCCCGGCACCAACAGCCACGACCGCTTTACGGGATCAGGCCGCCCAGCCGACTTCCACTCCTGCCCCATCCGCAAGGGTGGCACGACGTGGAGGCCGGAATATCAGAGGTGCGGGTGCCCAGAATCCCGGCCCGCGATCCCAACCACAGCCTCGCCCCCTTCCTCCGCCCCCGTTAAGCATGGACGAGGGCTGGACAGAAGTGGTGAAGCGGGGCACCACAGCACGGCGACAGATAGCAGCTCTGGCAGCTCCCCGAGGGGGTCGAGCGCCGACCGCTACATCCCGAAACACAGCGCTGGCGGCCGTGACTGCTCCCCGCGAGGGTCGAGCACCGGCCGTTGGCAAAAAGAAAAACAAAAGGAAGAAGCCGCGCGCAGCGGGGTCGGCTGCCGTGGTAGTGACTTTGCTGCCGGCCGCTGCCGAAAAGGGCCTCACCTATAATGAGGTGATGGCCCGGGCGCGTGCAGCTGTAAACTTGACCGAAATCGGGGCAGAGGAAGGTCTACGCTTCCGGCACACCGCCAATGGGGCGAAAATGCTGGAGTGTCCCGGTGCCGATAGTTCTGGCATCGCGGACAAACTAGTGGCGACGCTCCGCGTGGCATTGCCGGAGGAAGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGGATCACCGGCCTGGACGACTGCGCCACCAAGGAAGAGGTGGCAGCCGCGATAGCCGCCCAGGGGGGATGTGCTCCGGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGGTACTCCGGGGCCAGATCGGCGTGGGCGCGCTGCCCTGTGGAGGCGGCCACTTCCTTGGCCACCCCTCCACCGGGAAGATCGACGGGGGATCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGCCTCCGATGTTTTAGCACGGGGCACGGCCTCGCTAGGTGCACCAGCTCGGTTGACCGCAGCGGTCTTTGTTTCCGTTGCGGCCAGCCGGGCCACAAAGCAGCGTCCTGCACGGCCACCCCGCACTGCGCTCTGTGCGCTGCGGCCGGGCGCAGGGCAAACCACCGAGCGGGAGGCAAGGCGTGTTTCCCGTCCGGTAACAACACCGAACGAAACCGGCGCCGGAGATCAAAGCGCCGGCAAAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGTTGCGGCGCCGGTGCCGGAGGGCGGGGGCAGCAGTGAAAGGGAGGGGGCGATGGATGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGCTGGTTTGGGGACGACGGCGGCCTGGCGGCCATAGTCATAAGAAGGGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGAAGCTGGAAGAGACCGTCGTGATCGGGGCATACTTCTCTCCGAACAGGCCTACCGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTAAATGCGAAATCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAAGGCGAGTCTATTGTGGACGTTACGTTCGCGAGCCCGGCCATCGCGCGTCGTATCCGCGACTGGAGGGTTTTGGAGGGGGCGGAGACACTGTCCGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGCCCACAGGGATTACCCACGTGGTGCGCCCCGGTCATTCCCCAGGTGGGCACTGAAGCGCCTGAATAAGGCGCTACTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACATCCGGTTGAGGTCGAGGGCGAAGCGGGGTGGTTCCGGGACACGATGCGTCGCATCTGCGACGTATCGATGCCCCGGATCAGCCCTCGGTCTCCCAATCGCCAGGCGTACTGGTGGTCGTCCGAAATCGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCTAGGCATCGCCGCCGTCGCCTGCCGCGTCGCAACGATCCGGTTGCGTTCGCGCTGGTGGAGGCCCGGCTGTACGGCGCATTTCGCGTCGCGCAGAGGGCTTTGCAGCTGGCCATCAGAAGAGCCAAGGATCAACACATGGAGGGTCTCTTGGAGACGCTCGATGGGGATCCGTGGGGGCGACCCTATCATATGCCTCAGCAGCTGCGGGAAATCGTCTCGGCGCTGTTTCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACCCCCCGTCAGAATACGACGGCGACGTCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCATGTGGCAGTGCGTAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTGGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCTGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTAGTCATGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGTCCCTCTCGGATGAGGCCGTCTCCGGGGGTGGGGTGGCTTTGGCGGTGTCACTCGATATCGCCAATGCGTTCAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACACGGAGTGCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAAGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTCCTTCCCAATGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGGCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAG
Protein
MGSGGSCLYWSEPRGRKPLQKCPNLKLDTRRWDVWLEGFQSRGCRRSQGTKPLVNKKGINRNDGQLYKVSTPGGYRPRVGRRIPPCFHLSGSTLPHVFWGGNNCQDEGGCATGSGIPVELRRSPIAGSMRSALASDSGAVNPTRPSVGKKRGRRKTPLSTSDDGGASSSSTEVPEKTMAIEEVAPVVAGPAAKKETMPAPQWAPVRRRGAVSPATSVESMSTSAASLASGDEAFRDLDLALVNLAKLLSTVAAKGAEPGSSYRKRLREGAAMELPRLARGDSLVADACAGTLWASREEDGYQRALTTRDECGGAHASAYFCGPCSTSAYSRAPSPPRRVELRPAPPPQISATPASVQRGRLRPAPAQAEDIRSPLARMIDEWPALPRPRPAEPPSREEMAACISRAVAVEVRKHFAGLEEMLRSSIGSGDGVPAPTATTALRDQAAQPTSTPAPSARVARRGGRNIRGAGAQNPGPRSQPQPRPLPPPPLSMDEGWTEVVKRGTTARRQIAALAAPRGGRAPTATSRNTALAAVTAPREGRAPAVGKKKNKRKKPRAAGSAAVVVTLLPAAAEKGLTYNEVMARARAAVNLTEIGAEEGLRFRHTANGAKMLECPGADSSGIADKLVATLRVALPEEEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCAPESVTVGELRSGYSGARSAWARCPVEAATSLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTATPHCALCAAAGRRANHRAGGKACFPSGNNTERNRRRRSKRRQKRRLARGALANAVIPVAAPVPEGGGSSEREGAMDDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPLAMVTRGQGFVAVKLEETVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWANAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADAHRDYPRGAPRSFPRWALKRLNKALLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDVSMPRISPRSPNRQAYWWSSEIAQLRVECVRARRECARHRRRRLPRRNDPVAFALVEARLYGAFRVAQRALQLAIRRAKDQHMEGLLETLDGDPWGRPYHMPQQLREIVSALFPQEREGFVAPAMDPPSEYDGDVPAEVPHITGAELHVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVMVGPDLSAEQYGFREGRSTVDAILRVRSLSDEAVSGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPTFAGWWVPTWKTDRSRVPDTVGSCTGSRSCAVFHRDDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADQPQCGQSAEGPISAVRAGGMVQTAGRSFGWS

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=2.06394e-11,     Score=172

Ontologies

Topology

Length:
1694
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.561759999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00007
outside
1  -  1694
 
 

Population Genetic Test Statistics

Pi
15.958352
Theta
105.96741
Tajima's D
0
CLR
203.829372
CSRT
0.362581870906455
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号