SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09767
Pre Gene Modal
BGIBMGA012927
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.955 Nuclear   Reliability : 1.81
 

Sequence

CDS
ATGCATTCCAAGGGGATACCGGAAGCAATATATACCAAAACTGAAGCTCTATGGCAAGAGTTCGTAACCACTAGCGACCGGAATGTTGCTCTCGAACTCATTGAGTCCCTCAATGAAGCACGACAAGCTAAATGGGAAAGCACAGTCCAAGACATGAACTTCGCACTCTCAAGCCGTAAAGCCTGGCACCTACTTAAACGCTTCACTTCTGGAACTGCCATCCAGAAGAGTGAACCAAAAGTATGCCCCAGCAAAATTGCGGATAGGATTGTAAAATTGTCTAAAGCACCCAGCCACAAAAAACACACCCGTGAGGTGCGTAAGGATCTTGAATCTCTTAAGACAGACACTGCTCCAGGCCCCTATTTCAGCCGTCCAGTTACAGCAGACGAGATAACTGCCAGTATCAGAGCTATTAAGGGAAACAAAGCTTGTGGAAAAGACAAAATCTTTCCAGAGCTCATAAAACACAGTGGACCCCACACCCCTGCTTACGACACAGTGTGGCGCCAGGGACTGCTGTACAAACTACTCAAGCTGATCCCCTATATAAAGATCTACAAAGTTATTGAGGACGCCCTTACTAACAGACCATTCCGTGTCCATCTGGGAGATAAGTCTAGCTTATCGAGGGTCCTGAACAACGGCCTCCCGCAGGGCTCAGTCCTCACACCAACACTCTTCAACGTGTACACCCACGATTTGCCAGAGACGCTCTCCAGGAAATTTGCGTACGCTGACGATCTAGCTCTAGTCGCACAAGGTCGCAGTATAGAGACAACAGAAAGTCACCTTTATAACGACATGACCACGCTTGATGACTACTTCATTCGATGGCGCTTCGAAATTGAGAACCAGGAACAATATGCTAAAAAAGCTGACAGGGACAACGTGGGGGATGCTCGGCAGCGACGCGTCCTGGAAGGCAATGCTCGACCTTTGAGAGTCCATCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCTGGGATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MHSKGIPEAIYTKTEALWQEFVTTSDRNVALELIESLNEARQAKWESTVQDMNFALSSRKAWHLLKRFTSGTAIQKSEPKVCPSKIADRIVKLSKAPSHKKHTREVRKDLESLKTDTAPGPYFSRPVTADEITASIRAIKGNKACGKDKIFPELIKHSGPHTPAYDTVWRQGLLYKLLKLIPYIKIYKVIEDALTNRPFRVHLGDKSSLSRVLNNGLPQGSVLTPTLFNVYTHDLPETLSRKFAYADDLALVAQGRSIETTESHLYNDMTTLDDYFIRWRFEIENQEQYAKKADRDNVGDARQRRVLEGNARPLRVHHLAEGGGGAREGELFPFRTDPSPSSRGLGYARTSRPL

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal

Ontologies

GO

Topology

Length:
354
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00102
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00843
outside
1  -  354
 
 

Population Genetic Test Statistics

Pi
4.989776
Theta
2.210653
Tajima's D
3.350387
CLR
0.078627
CSRT
0.992200389980501
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号