SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09751
Pre Gene Modal
BGIBMGA009703
Annotation
PREDICTED:_uncharacterized_protein_LOC105842068_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.264
 

Sequence

CDS
ATGGAGAAAACGAGAGCCTTGCTTTTGGATGGAGCTGTACCCAAATATCTCTGGGGAGAAGCATTACTAACAGCTAGCTTCTTATTAAACCGATGTCCAACAAAAGGAAAAAATAAAACTCCTGCGGAATTGTGGTTTGGAATAAAACCAGATGTTTCAAATATTCGAAGATTTGGCTCAACTACATATTTTAAAATAAATTCTGGACTAAAAAAGCTTGATGATCGTTGTAAAAAGGGTATTCTGGTTGGCTACGTAAGAAACGGTTATAAAATTTGGGTTGAAGATGAACAAAAAATTATACGAGCAAGGGATGTAAGAATTAATGAGGGAGAACAAGGAATTCTAGGTGGATACTTAGAAGATAATGAAGTAATTAATGGGCTTTGGGGTGATGAAAGGGAGAACACTAATAGAAATAACACAAATGAAAATAATCGTGCAGATGATGAAGTCAGAGAAGTTCGAGAAGGTGATTTTAGAGGAAATAATAGTAATGAAGGTAATGAAGTTCGAGAAGGTGAAATAGGAAGAAATGGAGAGTTAGTGGAGTTCGAGAAGGTGATATTTGAGGAAATAATAGTAATAAAGTAG
Protein
MEKTRALLLDGAVPKYLWGEALLTASFLLNRCPTKGKNKTPAELWFGIKPDVSNIRRFGSTTYFKINSGLKKLDDRCKKGILVGYVRNGYKIWVEDEQKIIRARDVRINEGEQGILGGYLEDNEVINGLWGDERENTNRNNTNENNRADDEVREVREGDFRGNNSNEGNEVREGEIGRNGELVEFEKVIFEEIIVIK

Summary

Pfam
PF13976   gag_pre-integrs        + More
PF07727   RVT_2
PF00665   rve
Interpro
IPR025724   GAG-pre-integrase_dom        + More
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
ProteinModelPortal

Ontologies

Topology

Length:
197
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.2441
Exp number, first 60 AAs:
0.2441
Total prob of N-in:
0.07769
outside
1  -  197
 
 

Population Genetic Test Statistics

Pi
290.499137
Theta
172.753705
Tajima's D
2.144054
CLR
0
CSRT
0.903454827258637
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号