SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09710
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.868
 

Sequence

CDS
ATGTCGTCAGGTAGTTATTTATTAAATGTGCCGAAATTAAAAGGACGCGAAAATTATGACGACTGGGCATTCGCAGCAAGAAACTTTCTTATCTTGGAAGGCATAGACATCGACGCCATTCCGGTTGATTTGAGTCATGCCGAAGACCGAAAAGCGAAAGCAAAACTCGTCATGACCATTGATCCCAAGCTATATGTGCACATCAAAAATGAAACCAAAGTCAAGGATTTGTGGCAGAAACTACAAAAGTTATTCGATGACAGCGGGTTCACAAGAAAAATCAGCCTACTTCGAACACTGATATCCATTCGACTTGATAATTGTGAATCCATGACAAGTTACGTAAGTCAGATAGTGGAAACTGCACAAAGACTAAAAGGTACAGGGTTTGAAATTAATGAGGAATGGATCGGATCATTGCTGTTGGCGGGGCTGCCAGAAAAGTTTGCCCCGATGATTATGGCAATAGAACACTCCGGAATTGCCATAAATTCTGATGTCATAAAAACCAAATTGCTTGATATGAGTTCTGAGGTAGGTGACCATGACTCAGAAATTGCATTATGGTCGAAACAAAAACGAAGGGTAGATCAAAATTTTAATAAAAAATTTGAAAAACCAACTTCAAATTACACGCAAAATGTAAAAAAGATTATAAAATGCTACAAGTGCAAGAAAATTGGCCATTTTAAGAATCAGTGTCCTGAATTGAAAGAAAAGCAAGTAAACGCATTTAGTGCTGCTTTTTTTCATAGTGAATTTAATAGGGAAGACTGGTATATCGACTCAGGGGCTAGTGCTCATATGACATCAAGCAAAGAAAACTTATTGCAAGTGAGAAAAGTACACGATATGAAGGAAATTATTGTTGCAAATAATATGACTGTGCCAGTAGTGTGTGCCGGAAATTCACAGATTACTACTGTTGTGAATAATTCTCAGTTTGATATTAAGGTAAACAACATTTTATACATACCTAATCTAACAACAAACTTATTGTCAGTAAGCCAGTTGATAGCAAGAGGAAACAAAGTTTCTTTCAAAAGTGATGTATGTTATATACATAATCAACGAAATGAGCTTATTGGAATAGCAAATCTACAAAATGGTGTGTATAAGTTGAATACAGTAAGATCAGAGAAAGTGTTGGCGGCAGCAGTTCAGACTACAGATGCAAAACAGTGGCACAGAAGATTGGGACACATTAATAGTAATGATTTGCAGAAGATGAAAAATGGTGCTGTAGACGGAATATCGTTTGATATGAAGGCTAATATAAAAAAATCCAACTGTCAAGTATGTTGTGAAGGGAAACAGAGTCGTTTACCGTTTCAATTACGAAACCATAGAAGTACAGAATTGCTAGATTTAGTTCACTCAGATCTGTGTGGGCCTATGGAGGTTCGATCGATTGGACAGGCAAGATATTTTCTATTGTTTGTTGACGATGCTAGCAGGATGGCTTTTGTATATTTTATAAAGGAGAAGAATCAGACTCTACAGCGTTTCAAGGAATTTCAAAAAATGGTTGAGAATCAAAAAGGAACAAAGATAAAAACATTGAGAACCGACAATGGAGGGGAGTTTTCTTCAGATATGATGGAAAATTATCTGATAGATAGTGGAATTATCCATCAGAAGACGAACCCATATACTCCGGAGCAGAATGGTCTCAGCGAACGTTTCAACAGGACTATAGTTGAACGTGCAAGATGTTTATTGTTCGAGGCCAAACTGGATAAAAGTTTTTGGGCAGAAGCAGTTAACACGGCAGTATACTTGAAAAATAGATCACCGGCTTCAGGTTTGGACCAAAAGACACCGATTGAAGTATGGACAGGACAAAAGCCTGATCTCAGTCATGTCAGAATATTTGGGAGCCCAGTAATGATGCATGTTCCTAAAAATAAAAGATTGAAATGGGACAAGAAAGCAGTTCAATTCATATTAGTGGGGTATCCAGAGAATGTAAAAGGCTACAGATTGTACAACTTAGAAACTAGAAAAATATGTACCAGCAGAGATGTCATTGTAATGGAACCAGATACTACTCAAATAGAAATAAACGAAGGACAGATAGAAAAACAGCAGTCAGCACAAGAGGAAAGTTCTACTGAAGAAAGTGAAATAACATTGACAAATCAGGATGATCCCACTTATGTATATGATTCAGAAAAAAGTACAACTTCTACTGAAGGAGACTCTTATCAGACATTATCTGAAGAAGAAGAGCTATCTGAGAAAGAAGAGCCTCGATTGGTGGAAAAGCGTACCAGGAAACCTCCTGAAAGGTATGGTTTTACCAATCTTTGTATTTCAGATGAACCAGAGTCTTGGTTTGAAGACATAACTTATGATGAAGCTACCAACGGTCCAGAGAAAGACAAGTGGCAGCAGGCTATGTCTGATGAACTTCAAGCGTTTGAAGACAACCAAGCGTGGGAGATTGTTAAACAAGAGGAGGCAGATAGAGTAGTACAGTGCAAATGGGTGTTCAAGAAAAAGCTAGAAAGCAATAACAGTGTTAGGTAA
Protein
MSSGSYLLNVPKLKGRENYDDWAFAARNFLILEGIDIDAIPVDLSHAEDRKAKAKLVMTIDPKLYVHIKNETKVKDLWQKLQKLFDDSGFTRKISLLRTLISIRLDNCESMTSYVSQIVETAQRLKGTGFEINEEWIGSLLLAGLPEKFAPMIMAIEHSGIAINSDVIKTKLLDMSSEVGDHDSEIALWSKQKRRVDQNFNKKFEKPTSNYTQNVKKIIKCYKCKKIGHFKNQCPELKEKQVNAFSAAFFHSEFNREDWYIDSGASAHMTSSKENLLQVRKVHDMKEIIVANNMTVPVVCAGNSQITTVVNNSQFDIKVNNILYIPNLTTNLLSVSQLIARGNKVSFKSDVCYIHNQRNELIGIANLQNGVYKLNTVRSEKVLAAAVQTTDAKQWHRRLGHINSNDLQKMKNGAVDGISFDMKANIKKSNCQVCCEGKQSRLPFQLRNHRSTELLDLVHSDLCGPMEVRSIGQARYFLLFVDDASRMAFVYFIKEKNQTLQRFKEFQKMVENQKGTKIKTLRTDNGGEFSSDMMENYLIDSGIIHQKTNPYTPEQNGLSERFNRTIVERARCLLFEAKLDKSFWAEAVNTAVYLKNRSPASGLDQKTPIEVWTGQKPDLSHVRIFGSPVMMHVPKNKRLKWDKKAVQFILVGYPENVKGYRLYNLETRKICTSRDVIVMEPDTTQIEINEGQIEKQQSAQEESSTEESEITLTNQDDPTYVYDSEKSTTSTEGDSYQTLSEEEELSEKEEPRLVEKRTRKPPERYGFTNLCISDEPESWFEDITYDEATNGPEKDKWQQAMSDELQAFEDNQAWEIVKQEEADRVVQCKWVFKKKLESNNSVR

Summary

EMBL
AGBW02009826    OWR49812.1    GEZM01011856    JAV93393.1    GEZM01011857    JAV93390.1    + More
GALX01001351    JAB67115.1    GEZM01011858    GEZM01011854    JAV93389.1    LBMM01004924    KMQ91985.1    KQ460297    KPJ16236.1    JXUM01099713    KQ564513    KXJ72145.1    KQ459875    KPJ19636.1    NWSH01002292    PCG68657.1    PCG68658.1    GEZM01011855    JAV93396.1    NWSH01000816    PCG74073.1    GEZM01011859    JAV93384.1    GEZM01045162    JAV77889.1    GFTR01008662    JAW07764.1    GBXI01011094    JAD03198.1    GANO01000510    JAB59361.1    GBHO01020706    JAG22898.1    GBHO01003630    JAG39974.1    GEHC01000991    JAV46654.1    GANO01000659    JAB59212.1    GANO01000660    JAB59211.1    GEHC01000990    JAV46655.1    GEHC01000989    JAV46656.1    GAKP01015352    JAC43600.1    GBHO01033237    JAG10367.1    GEHC01000988    JAV46657.1    GEHC01000867    JAV46778.1    GEHC01000868    JAV46777.1    GBHO01026221    JAG17383.1    KL367628    KFD61291.1    GBHO01033235    JAG10369.1    KQ460882    KPJ11482.1    JYDT01000069    KRY86576.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    JYDR01000001    KRY80095.1    NEVH01019375    PNF22597.1    JYDH01000330    KRY26802.1    KL367553    KFD64618.1    JYDJ01000808    KRX33413.1    NEVH01002725    PNF41351.1    NEVH01006721    PNF37230.1    NEVH01006980    PNF36330.1    JYDJ01000136    KRX42725.1    GBHO01036544    JAG07060.1    GBHO01011746    GBHO01011744    GBHO01011742    JAG31858.1    JAG31860.1    JAG31862.1    JYDQ01000379    KRY07987.1    GEDC01002834    JAS34464.1    GDHC01012180    JAQ06449.1    JYDK01000071    KRX78146.1    GEZM01045163    JAV77888.1    LBMM01008124    KMQ89126.1    AAZX01000499    KQ460208    KPJ16606.1    KRX78123.1    GBHO01026200    JAG17404.1    GDHF01030254    JAI22060.1    GFTR01008771    JAW07655.1    GEZM01013472    GEZM01013471    GEZM01013470    JAV92539.1    JXUM01099923    KQ564528    KXJ72133.1    LBMM01012645    KMQ86082.1    KL367691    KFD60150.1    GDHF01029191    JAI23123.1    JYDL01000068    KRX18751.1    GAMC01019995    JAB86560.1    KA648745    AFP63374.1    JYDU01000001    KRY01876.1    AAZX01000798    GBXI01002679    JAD11613.1    GAMC01018156    JAB88399.1    GAMC01018157    JAB88398.1    GAMC01019998    JAB86557.1    JYDM01000185    KRZ84108.1    GAMC01018154    JAB88401.1    GBXI01016677    JAC97614.1    GBXI01000292    JAD14000.1    JYDP01000350    KRZ01021.1    KL367527    KFD66146.1    JYDL01000297    KRX12674.1    KL367480    KFD71809.1    JYDN01000113    KRX56900.1    GDHF01006360    JAI45954.1    QGNW01000024    RVX13462.1    GAMC01018338    JAB88217.1    GAMC01019997    JAB86558.1    JYDO01000104    KRZ71003.1    GAMC01020352    JAB86203.1   
Pfam
PF13976   gag_pre-integrs        + More
PF00098   zf-CCHC
PF00665   rve
PF07727   RVT_2
PF13961   DUF4219
PF00078   RVT_1
Interpro
IPR025724   GAG-pre-integrase_dom        + More
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
IPR025314   DUF4219       
IPR000477   RT_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
1C1A     E-value=0.00270093,     Score=100

Ontologies

Topology

Length:
843
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00874999999999998
Exp number, first 60 AAs:
0.00057
Total prob of N-in:
0.00026
outside
1  -  843
 
 

Population Genetic Test Statistics

Pi
52.437282
Theta
122.770114
Tajima's D
-1.453695
CLR
220.842516
CSRT
0.0694465276736163
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号