SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09696
Annotation
PREDICTED:_uncharacterized_protein_LOC105842415_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.794
 

Sequence

CDS
ATGAGTGAGAAAGAAGAAAAGGAGTTAGTTAAAAAACGAGCTAGTCTAAAAGGCCGATTGACTACATTCAGAAAGTACATCGAGGAATTGAGCGGTACGTTGAATCAGCAACAAGTCAATGAATTGCAATTAAGAATCGGTAAGATCGAATTATTATTTGAACAATATGACGTAGTACAAACTAAAATAGAATGCCTCGCTGACGATTTCAGCTCGCAAAGCACAGAGAGAGAAGATTTCGAATCGATTTATTACAAATCCCTTTCACAGGCTCAGGAGATTCTTTCTCGTAATTCTAAATTTCTACCCAAATTTGATGGTTCATATAGCAACTGGCTGGAATTCCATGACACCTTCAGTAGTCTTATACATTCGAACGAGGCGATAGGAGAAATTAATAAATTTCACTACCTCAGGGCCTCGCTAGAAGGCTCTGCTGCTGTACTACTTCAGGAGATTCAGTTCTCTGCCAGCAACTATTCTGTGGCGTGGAAGCTGTTATGTGAGAGGTACGATAATAAGCGCCTATTAATTCAAACACACGTTAATAATTTATTTAATATAGACGCAATAAAGAGTGAATCTTCGTTTAATTTAAGACGTTTCATAGATCAGCTGAATAAAAGCCTGAGAGCTTTACAGTCGCTGGGCGAACCGACTGATCATTGGGACACTCTTCTCATCCACATGTTGAGTCGTAAAATCGAACAGAAGACGCTGCGAGAATGGGAAGAGTGCAAAGGTCGTCTTGATAAAGAAAAGCCCATTTCTTTGTCCATATTTCTCGATTTCATTCGTAACCGGGCCGATCTATTAGAAACGATGGAATTTACTCGTTCTAATCTTCCTCACACACAAGATCAGCCACCACAGTCGCCTAAAGGTCAGAAAATTAAAACATTACTTTCTGTCTCCGGAACGCAGCCGTCGTCGAGTGGCGGCGCTAGTATTATTTCTGGTTCCGGTACAACATCGTGCCCACACTGTAAGGGTGAGCATTATCTTTATAATTGCGATAAATTTCTGAGCCTTAATAGTGAGCAGAGATGGGAATTAATTCCTCAGTTCAAGGTGTGTTACAACTGCTTTCGTAGTGGTCACTATTCGAATCGCTGCAAAAAAGGTGGTTGTACTTTATGTAAGCGTAGGCATAATACGCTGCTGCACACCTCTTCTAATAATAAACAGGGAATTAATCACCCCGCTCCTAAGCGTGACACCGCGGCAATCGCCTCCGCCATCCAGCCTGAACCTCCTGGTAACCATGGCCTAACGTTAGCCACGTATTCTGCCGCCGCACCTTCAGAGATTAGTAAAGATGGTATGTTTGCGACAGCTCTCGTTAAAGTTGTCGATAGTAATGGTCACGAGCACATCATACGTGCTCTTCTGGATTGTGCGAGTTCGTCTTGCATAATTAGTGAGAAAACGGGTCGCTTATTGAATGCCAAGTATATTGATATAGATAAACCTATTTTCGGCATCGATAAGACTAGAACTAACACTTCAAAAATGTGTTATGTTTCTTTCAGTTCACGCACTGAAAATTATTCAAAATGTCTTCTTTGTTATGTATTGCCTTCCATAACTGACGACGTGCCTTGCCATTCATTTGATGTTTCGCATTTAAATACTCCCGCTAATATTATTTTAGCCGATCCCCAATTTTATAGGGCGTCAGAAATTGACATGATAATTGGATCTAATATCTTTTGGGATCTGCTCGGGACGCGAAAGATCAATCTGGGAGATAACATCTCGATCCTCTGGGAAACTCGACTTGGCTGGTTGGTAGTTTCCAGGGATCTAAGTGATGGTCATGGATCTGCTCCCCTAATGTGCAACTTCACAAAACTTGCAGACATTTCAAAAGATCTTGATTTCGGCGTTGATGACACTCAGAACTTGCTGTCGCGGTTCTGGCAGCCGAAGGAAGTCGGCCTTAAGTCATCCTACTCCGAGGTGGAACGAAAATGTTTAGAACATTTCATCGGCCTTGAATGCAGTGACAAGAACATCTCAGAGATCATCATTCACGACTTCTACGTGAATGATCTCCTCACGGGGTCTGACTCATTTCAGGAGGCGTTGGACATTAAAAAAAAAGTTGCCGCAGAGCTTGCCTCCGCCAGGATGCCTCTGCGCAAGTGGAAGTCCAACGATCCTCTACTCTGTCTTACCGGTGATCCGTGTGACGATAGTTCGTCCCTCAGTTTGAATATCGGGTCCTTTGAGTCTTGTAAGACATTAGGCCTCAATTGGCAGACAGCCACAGATGAGCTTTCTTTCTCTGTCGATTCGTGTGAAGCCTCGCCTTCTACGAAACGCTCTATGCTTTCTGTCACTGCATGCATTTTTGATCCCATGGGGTTAGTTTCTCCCTGCATCGTTCCTATTAAAATACTATTGCAGCGGCTATGGGTTCATAAGCTATCATGGGACGAACAGCTCCCATTTGAAATAGCCAAAATTTGGGCTAATTTAATTAAAAGCCTTCCGCTTTTAAATAATTTACGCATACCTCGCCTTATTGGTTGCGAGGCTTATACTTACGTGGATCTCCACATGTTTACCGATGCGTCGCAAAGCGCATATGGTGCTTGCCTTTACGTGCGAAGCGCGGACGTGTATGGACGAATCAAGGTCTCGTTACTTATTGCCAAAAGTAAAGTGGCTCCATTAAAGCTAACGACGATCCCTCGGTTGGAGCTCTGCGGGGCTCTGGTAGGAGTGCGCCTCTATGAGAAGGCTATTGATTCACTCCGGGTTCAGGTCAGGCATACTACTTTTTGGACTGACTCGACGATTGTGTTAGGCCGGCTTAAAATGTTGCCTAGTATATTACAGCCTTTCGTTCGCAATCGTATGGTGGAGATCATGGAGAAAACCGTGAACTGTACCTGGCGTCATGTTCCCACTGATGAAAACCCTGCTAATCATATTTCTCGCGGCGTCGAAGTCGTAAATTTGCAGGGTCTAGATCTGTGGTGGTCAGGTCCTCAATTTCTGCAGCAAGACTGCTCTCAGTGGCTTTCCAATTCAGGCCGGTACAGCGACTCCAAACTCCCTGAAGTTCGTCCTGAAGTCTCGTTGCACCTTTCAGTTCCACGTGATGATTCATTTATTGATTTCAGCCGATTCTCAAACCTATCTCGACTAAAACGTGCTGTAGCCTATGCATTGAGATTCATAAATGTATGCAGAAAGCTATATCCATAA
Protein
MSEKEEKELVKKRASLKGRLTTFRKYIEELSGTLNQQQVNELQLRIGKIELLFEQYDVVQTKIECLADDFSSQSTEREDFESIYYKSLSQAQEILSRNSKFLPKFDGSYSNWLEFHDTFSSLIHSNEAIGEINKFHYLRASLEGSAAVLLQEIQFSASNYSVAWKLLCERYDNKRLLIQTHVNNLFNIDAIKSESSFNLRRFIDQLNKSLRALQSLGEPTDHWDTLLIHMLSRKIEQKTLREWEECKGRLDKEKPISLSIFLDFIRNRADLLETMEFTRSNLPHTQDQPPQSPKGQKIKTLLSVSGTQPSSSGGASIISGSGTTSCPHCKGEHYLYNCDKFLSLNSEQRWELIPQFKVCYNCFRSGHYSNRCKKGGCTLCKRRHNTLLHTSSNNKQGINHPAPKRDTAAIASAIQPEPPGNHGLTLATYSAAAPSEISKDGMFATALVKVVDSNGHEHIIRALLDCASSSCIISEKTGRLLNAKYIDIDKPIFGIDKTRTNTSKMCYVSFSSRTENYSKCLLCYVLPSITDDVPCHSFDVSHLNTPANIILADPQFYRASEIDMIIGSNIFWDLLGTRKINLGDNISILWETRLGWLVVSRDLSDGHGSAPLMCNFTKLADISKDLDFGVDDTQNLLSRFWQPKEVGLKSSYSEVERKCLEHFIGLECSDKNISEIIIHDFYVNDLLTGSDSFQEALDIKKKVAAELASARMPLRKWKSNDPLLCLTGDPCDDSSSLSLNIGSFESCKTLGLNWQTATDELSFSVDSCEASPSTKRSMLSVTACIFDPMGLVSPCIVPIKILLQRLWVHKLSWDEQLPFEIAKIWANLIKSLPLLNNLRIPRLIGCEAYTYVDLHMFTDASQSAYGACLYVRSADVYGRIKVSLLIAKSKVAPLKLTTIPRLELCGALVGVRLYEKAIDSLRVQVRHTTFWTDSTIVLGRLKMLPSILQPFVRNRMVEIMEKTVNCTWRHVPTDENPANHISRGVEVVNLQGLDLWWSGPQFLQQDCSQWLSNSGRYSDSKLPEVRPEVSLHLSVPRDDSFIDFSRFSNLSRLKRAVAYALRFINVCRKLYP

Summary

Pfam
PF03564   DUF1759        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF05585   DUF1758
PF12259   Baculo_F
PF17921   Integrase_H2C2
Interpro
IPR005312   DUF1759        + More
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR001995   Peptidase_A2_cat       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR022048   Envelope_fusion-like       
IPR041588   Integrase_H2C2       
SUPFAM
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
1072
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01101
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1072
 
 

Population Genetic Test Statistics

Pi
690.729343
Theta
241.286745
Tajima's D
5.85783
CLR
0.334223
CSRT
0.999950002499875
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号