SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09682
Annotation
PREDICTED:_uncharacterized_protein_LOC101745010_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.874 PlasmaMembrane   Reliability : 2.23
 

Sequence

CDS
ATGCCAGATTCACTGTGCGCATGCGCATTGGAACAGCAGTGTTTTAAGACGGTATGTAATCAGCAGCCCACTAAAACTATATTGCTTGGTACAGCGATATGCAATATTATGGACAATTCAGGCACGTTCTTGAGTACTGCCCGAATATTGGTAGATAGTGCATCGCAACGAGATCTGATTACTCTTGAATTTTGTAAGAGACTTAATTTACCAATTTATCCTTCCGAAACAAAGCAAGTGTGCGGAGTGGGTGATGTGAAAAATTCCATTGAAGGATATTGTTGTCTAACACTTTGCTCTTGTACTGAAGAATCAGTGCGTATTACAATACAACCTCTGGTAATCAATAAAATTACAGGTGAACTTCCTACCTCAAAGATCGATACTTCAAGTCTTAATTATCTAAAACACATTAAGCTAGCTGATGACAGATTCTCACAGCCTAGTGGTATAGATTTGATTGTGGGTTCCGATGTATTCTCTCGAATTTTACGACCTCATATAATTTCTAGGGCCCCCGGTGAACCTGTAGCAATTGAGACTTCATTAGGTTACATAATAGTCGGCCAGGCACCGGTATTAGCTCCCTCGATAGATAATTCATACTATACACATTGCACCTTTGGTGAGGACAATTTGGATAATGAGAATAATGCTTGTATTGGTAATTTTTTGAAATTAGAGGATATTCCAGACGTCAAGCCATACACGGAACAGGAAGAGGAGTGTGAAAGCCTTTATAGACAAACGACTACTCGTGATAGCTTAGGTCGTTACATTGTCTCGTTACCATTCAAAGATACTCCTAGTAAGCTGGGTGACTCATTACAGGCATCAATGCGTAGATATCTTTCATTGGAACGTAAGCTGCTATTGCAACCCGAAATGAGACAAGAATACGATAAAGTCATTAAGGACTATTTAGAAAAGGGATATTTAAACCCATGTTCTAGAAATATAAATGAGTCCTCACTCCACTATGTTATTCCCCATCACGGCATCGTTCGAAAGGATAAAAGTACAACAAAATTACGGGTAGTATTGGATGGCAGTATGAAATCATCATCGGGACTGGCACTGAATGATATATTACAAGTCGGACCGAATTTGCAAAACGACCTTTTTAGAATAATTTTAAATTTCAGACTTTTTAATGTAGCGATTAGTGCCGACATTAGGCAAATGTACTTGAGGATTTTAGTAAAGGACGAAGATAGGAAATTCCTGAGAATGTTGTATCGCTTTGATCCAAGCGAGGAGATAAAACTTTACGAATTCACACGTGTGCCATTCGGTTTGTGTTGTAGTCCGTTCCTTGCGATCAGGACTGTGCGCCAGTTAGTGACGGACGAGGGATCACAATTTCCTCTCGCGGCTCCAGTAGCTGACAGTGACGTTTTCACTGACGATTTGGCTACTTCCTGTGCGAATGAAGAAACAGCGGTCGAACTTTCTAATCAACTTATTAAAATGTTTCATGCTGGTGGTTTTGATTTGGTAAAGTTTTCAAGTAACTCACCAGAGGTTCTTTCTAAGATACCCTCTTCACATAGAGAATTCGAAGTTATAGAATTTAGTCCAGATAGCTATTTAAAAATACTGGGACTAAACTGGCTTCCAGCCGAAGACGTATTCACATTCACAGTAAATTTACGGAACCGCGAATGTACTAAAAGAAATATTTTATCAGTTATAGCAAGAATATGGGACTTAATGGGATTCGTAGCTCCTGTTACACTATGGGCCAAGCTCATCATTAAGTCACTATGGGCTAATAATATAGATTGGGATGAAACTCCTCGCCCTGAAATTGTAGCAGCTTGGCATCGATTCGTGTCTGAGTTGCCAATATTGGAAAATGTTAGAATACCACGACATACTGGCATTGTTATAGAGTGCATAGTTAGCTTATTGGGATTTGCTGATGCATCTGAAAAGGCCTATGGAGGTGTCGTTTATTTACATGTTTATTTTCCACAAACAAATAAGTTCACTATTACGCTTGTTTGTGCCAAATCCAGAGTAGCGCCGTTACGATGCGTGTCATTGGCAAGACTAGAATTATGCGGTAACTTGATTCTCGCAAAGTTGATGAGAGCAATTATTGACAGCTATTCTCATCGCTGTAAAATAAGTAATGTATTTGCCTTTACGGATAGCACCGTGGCTTTGGCATGGATTCACTCATCACCGGCTAGATGGCATACGTTTGTAGCCAACCGAGTAACAAAGATACAGGATGAAATACACCCCAGAAACTTTTATTTTGTATCGGGTAAAGAGAATCCAGCAGACTGTCTTTCACGCGGCTTAACACCATCACAATTGATGGAGCATCCTCTTTGGTTCAGTGGACCCCGATTTGCTCATCTACCCATTTCAGATTGGCCAGTTAAGAATTTTGATGCCACATCGATGACTGATATTCCAGAAATGAAACCAGCTATCATGCTATTCACAACTGATGATGCACGGAATGACAATATATTATACACGCTTGCATGCCGTATTTCATCATGGCCCAAGCTGGTCCGTATTGTACTTTATGTTCTCCGGTTTATTAAATTGGTACCGAGTAAATTTGATATTTCCCATTTAAAGGTGGCCGAAACGAATATCATCAAGGCTGTACAGCGAGTTCACTTTGATAAAGAACTTAAGAATGTGAAGTCTGGCAAAATATTACCGTCTGCATTTCAACGGCTCAGAGCCTTTGTTCACGAAGAAACGATAACGGAACATTCTAATCTCATCCAAAGGAAACGTATTGTAGACAGTTTGGTCCAGTCTTTTTGGAAAAGATGGAAACTTGAATATCTTAATACATTACAAGTTCGTAATAAATGGAAAAAAGATAGCACTCCTATTAAAACTGGCACAGTTGTACTGCTTCAATCTGAAAATAGTGCTCCTCTTAATTGGCCATTGGGTATAATAGAGGAAACTTTTCCGGGTCGTGATGGAGTTGTAAGGGTGGTTAACGTTAGAACGAAAACTGGTACTTATCGTAGACCTGTTGTTAAGGTTTATCCTTTACCAACACAGTAG
Protein
MPDSLCACALEQQCFKTVCNQQPTKTILLGTAICNIMDNSGTFLSTARILVDSASQRDLITLEFCKRLNLPIYPSETKQVCGVGDVKNSIEGYCCLTLCSCTEESVRITIQPLVINKITGELPTSKIDTSSLNYLKHIKLADDRFSQPSGIDLIVGSDVFSRILRPHIISRAPGEPVAIETSLGYIIVGQAPVLAPSIDNSYYTHCTFGEDNLDNENNACIGNFLKLEDIPDVKPYTEQEEECESLYRQTTTRDSLGRYIVSLPFKDTPSKLGDSLQASMRRYLSLERKLLLQPEMRQEYDKVIKDYLEKGYLNPCSRNINESSLHYVIPHHGIVRKDKSTTKLRVVLDGSMKSSSGLALNDILQVGPNLQNDLFRIILNFRLFNVAISADIRQMYLRILVKDEDRKFLRMLYRFDPSEEIKLYEFTRVPFGLCCSPFLAIRTVRQLVTDEGSQFPLAAPVADSDVFTDDLATSCANEETAVELSNQLIKMFHAGGFDLVKFSSNSPEVLSKIPSSHREFEVIEFSPDSYLKILGLNWLPAEDVFTFTVNLRNRECTKRNILSVIARIWDLMGFVAPVTLWAKLIIKSLWANNIDWDETPRPEIVAAWHRFVSELPILENVRIPRHTGIVIECIVSLLGFADASEKAYGGVVYLHVYFPQTNKFTITLVCAKSRVAPLRCVSLARLELCGNLILAKLMRAIIDSYSHRCKISNVFAFTDSTVALAWIHSSPARWHTFVANRVTKIQDEIHPRNFYFVSGKENPADCLSRGLTPSQLMEHPLWFSGPRFAHLPISDWPVKNFDATSMTDIPEMKPAIMLFTTDDARNDNILYTLACRISSWPKLVRIVLYVLRFIKLVPSKFDISHLKVAETNIIKAVQRVHFDKELKNVKSGKILPSAFQRLRAFVHEETITEHSNLIQRKRIVDSLVQSFWKRWKLEYLNTLQVRNKWKKDSTPIKTGTVVLLQSENSAPLNWPLGIIEETFPGRDGVVRVVNVRTKTGTYRRPVVKVYPLPTQ

Summary

Similarity
Belongs to the synaptobrevin family.
Belongs to the G-protein coupled receptor 1 family.
EMBL
GBBI01004276    JAC14436.1    GEZM01054789    JAV73399.1    GEBQ01015458    JAT24519.1    + More
GEBQ01000825    JAT39152.1    GEBQ01028569    JAT11408.1    GEZM01054766    GEZM01054765    JAV73410.1    JAV73413.1    RSAL01000392    RVE41994.1    GALX01004947    JAB63519.1    GEZM01085145    GEZM01085143    JAV60187.1    ABLF02066034    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    ABLF02030854    ABLF02067347    LBMM01012238    KMQ86334.1    GALX01000776    JAB67690.1    GGMR01002421    MBY15040.1    ABLF02008594    ABLF02041863    GGMR01017890    MBY30509.1    LBMM01009202    KMQ88311.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    ABLF02006304    ABLF02036268    GBHO01012499    GBHO01012498    GBHO01012497    GBHO01007479    GBHO01007451    GBHO01007450    JAG31105.1    JAG31106.1    JAG31107.1    JAG36125.1    JAG36153.1    JAG36154.1    GGMS01010524    MBY79727.1    LNIX01000069    OXA36894.1    KK114194    KFM61875.1    LBMM01009551    KMQ88039.1    ABLF02039606    GGMR01018294    MBY30913.1    ABLF02030698    ABLF02030705    ABLF02030709    GAMC01006864    JAB99691.1    ABLF02025193    GFTR01008874    JAW07552.1    LNIX01000007    OXA51795.1    GECZ01008071    JAS61698.1    GBBI01004211    JAC14501.1    LNIX01000036    OXA39969.1    LNIX01000016    OXA46198.1    LNIX01000074    OXA36769.1    GDHC01006469    JAQ12160.1    ABLF02042806    GBHO01007689    JAG35915.1    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    ABLF02036131    ABLF02041527    ABLF02064049    AXCM01013330    ABLF02005251    ABLF02055296    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    GFTR01008866    JAW07560.1    LNIX01000044    OXA38660.1    GGMR01017803    MBY30422.1    GGMR01010750    MBY23369.1    OXA51382.1    QOIP01000009    RLU19024.1    GGMR01018506    MBY31125.1    LNIX01000002    OXA59522.1    GDHC01014057    JAQ04572.1    KQ458473    KPJ05885.1    LBMM01010417    KMQ87475.1    GBHO01044316    JAF99287.1    GDHC01016272    JAQ02357.1    GDHC01014268    JAQ04361.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GBHO01028371    GBHO01028370    JAG15233.1    JAG15234.1    ABLF02035780    LNIX01000001    OXA61293.1    LNIX01000003    OXA58579.1    GALX01003264    JAB65202.1   
Pfam
PF00665   rve        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF03564   DUF1759
PF00078   RVT_1
PF13774   Longin
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00001   7tm_1
PF02145   Rap_GAP
Interpro
IPR008042   Retrotrans_Pao        + More
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR005312   DUF1759       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR011012   Longin-like_dom_sf       
IPR010908   Longin_dom       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR017452   GPCR_Rhodpsn_7TM       
IPR000276   GPCR_Rhodpsn       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF64356   SSF64356       
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF111347   SSF111347       
Gene 3D

Ontologies

Topology

Length:
1015
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0891
Exp number, first 60 AAs:
0.01558
Total prob of N-in:
0.00121
outside
1  -  1015
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
158.052143
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号