SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09604
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Mitochondrial   Reliability : 3.784
 

Sequence

CDS
ATGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCACCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCTACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTATGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGATATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCCTCTAATTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGCCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTTCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGCTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATTCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCAGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MGKLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIYKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFSSSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRAVPGQLSLRGVNVEFRPSVRYLGVNIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGQALPRELLEPPAMVR

Summary

EMBL
RSAL01000708    RVE41206.1    RSAL01000536    RVE41424.1    NWSH01000895    PCG73652.1    + More
ABLF02017815    ABLF02023911    GGMS01017914    MBY87117.1    ABLF02066620    ABLF02041767    ABLF02055645    ABLF02033522    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02008463    RSAL01000707    RVE41207.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMS01004685    MBY73888.1    KK113014    KFM59099.1    GEZM01074951    JAV64378.1    ABLF02010251    ABLF02035981    NEVH01017559    PNF23833.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    GGMR01004661    MBY17280.1    KK117880    KFM71667.1    ABLF02034467    GALX01005359    JAB63107.1    ABLF02025082    ABLF02039175    ABLF02041809    NEVH01023961    PNF17613.1    NEVH01003017    PNF40781.1    NEVH01023962    PNF17612.1    NEVH01007443    PNF35684.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01000280    PNF43672.1    NEVH01005938    PNF38077.1    NEVH01020071    PNF21969.1    ABLF02050434    ABLF02064867    ABLF02042518    ABLF02057746    NEVH01010546    PNF32261.1    ABLF02017813    NEVH01001355    PNF42855.1    ABLF02030319    ABLF02030320    NEVH01014858    PNF27387.1    GEZM01008457    JAV94772.1    NEVH01019964    PNF22161.1    NEVH01017470    PNF24199.1    NEVH01019376    PNF22596.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02029306    ABLF02029314    ABLF02060138    NEVH01000598    PNF43535.1    NEVH01007838    PNF34986.1    NEVH01006754    PNF36554.1    NEVH01021205    PNF19912.1    ABLF02029291    NEVH01002716    PNF41415.1    NEVH01009134    PNF33528.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    NEVH01026154    PNF14491.1    KK116883    KFM69009.1    ABLF02003961    ABLF02059872    KQ459259    KPJ02068.1    GALX01005300    JAB63166.1    NEVH01012084    PNF30905.1    ABLF02037507    ABLF02041173    ABLF02054117    GFXV01005866    MBW17671.1    GALX01005299    JAB63167.1    ABLF02028535    ABLF02028545    KK116445    KFM67824.1    GBHO01041571    GBHO01005400    GBHO01005396    JAG02033.1    JAG38204.1    JAG38208.1    ABLF02040650    ABLF02040651    ABLF02056776    KQ459265    KPJ02064.1    GBHO01041572    GBHO01041570    GBHO01010553    JAG02032.1    JAG02034.1    JAG33051.1    ABLF02014862    ABLF02014866    ABLF02061908    NEVH01016327    PNF25684.1    KQ459580    KPI99178.1    GGMR01019198    MBY31817.1    NEVH01019080    PNF22876.1    GFTR01008038    JAW08388.1    GGMS01000737    MBY69940.1    ABLF02016494    ABLF02066976    NWSH01000032    PCG80497.1    AB018558    BAA76304.1    ABLF02008933    IAAA01035747    LAA09607.1    GGMS01008766    MBY77969.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GGMS01012005    MBY81208.1    PCG80496.1    KQ971729    KYB24751.1    GEZM01101506    JAV52621.1    KK113137    KFM59425.1    GEZM01101509    JAV52620.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGMS01012393    MBY81596.1    GEZM01053022    JAV74219.1    AB055391    BAB21761.1    ABLF02008677    ABLF02011967    ABLF02052409    ABLF02056408    KK117974    KFM71881.1    GFXV01007093    MBW18898.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF03184   DDE_1
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR004875   DDE_SF_endonuclease_dom       
IPR036875   Znf_CCHC_sf       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.00605461,     Score=93

Ontologies

Topology

Length:
385
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03627
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00162
outside
1  -  385
 
 

Population Genetic Test Statistics

Pi
119.10385
Theta
166.668606
Tajima's D
-0.953593
CLR
31.844647
CSRT
0.141592920353982
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号