SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09603
Annotation
PREDICTED:_uncharacterized_protein_LOC105387844_[Plutella_xylostella]
Location in the cell
Mitochondrial   Reliability : 1.858 Nuclear   Reliability : 2.073
 

Sequence

CDS
ATGGTGCTCACACGGTCCGAGAAGATGAGGTCGTCACGCCTTGACCGGCCCGGCAACGAAGCTGTCTCGGGCTCAACATCACAAGACGCACAGCAACGAGCTGTGTCGGCCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCAACCTCCTCCCAGTCAACCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCACCCTCCTCCCAAGTGGAAAAGTGTCCGGGAGTGCCGCGGGGCTCACAAGCGATGCCCCCCTCCCGCCAAATATTGCCTACGCAATACTCGCCGGCGTCGCCAACGGGACCGAACAGCGGGGTCTGTCGTCGAGTGGTCAGACCCCCCAGCACCGCGACACCGGCAACAACTTCAGGCGACGCAGCAACGGAGAGCGTCGTATCCGCGAGCCAGAACAGAAAAGAGTCAGCGCTCACGGCCAATCCAATTGTACACGGGTCCCACATCACGGACGCCGCTGCCAAAATCTCGACGACAGAAGAAGGCTCCACACTCCGCGACGGGATGGCGCCACCAGTTCGAGGATCTTCGAGAAAGTCGAGTCAACAGTCACAACGGCTGTTGCTTATGGCGCGCCTCAAAGAAGAGCATCTTCGCGCCAAGGAAAAACAAGCCCGACTCCAAGCAGAGCTCGCCGCCGCCCGCATCTCAACGTTAGAAGCCGAAGCGCTCGTTGAAGAGGAGGAAGATGCGCGCACAACACTCACGGAGGACGAGAACGAGCAAACACAGCGCGTCGATACATGGCTCAGTCAGCAACGATCGATCGCGCTACAGGGAGTCGAAGAAAGAGTAATGCAGTCAACACACGGATCACCAGCCACCATCGAGCAACCGCAACTGGAACTTCCCGCACCAATAGAACAGCTGAAGCTACCGGCCCCTGCCGCGGCACCGATTGCCGTACCTGTCGCACCGAAGAGCGACATCGCCGAACTAGCAGCTGCCATCGCGACGGCCGCCCGCCAAGCCAGGCCCGGACCATCGCATCGGTACTACGGGGAGCTTCCAGTGTACAGTGGATCGCACCAAGAATGGCTCTCCTTCAAGGTCGCCTACGCCGAATCAGCGGACAGCTTCAGCGCCGCAGAGAATACTGCGAGACTTCGGCGTACGTTGAGAGGAAGAGCAAGAGAAGCGGTCGAAAACTTGTTGCTGCATTACACCGAGCCCGCCGAGATCATGCGGACTCTAGAATCGCGCTTCGGACGTCCAGAAGCAATCGCCGCAACGGAGCTGGAACGACTGCGCGCGCTGCCACGCTGCACGGACACACCGAGGGACATCTGCGTATTCGCGAATGAGGTGAACAACGTCGTCGCCGCTCTGAGGGCCCTCGACCGCGTACATTACATGTACAACCCGGAGCTCACTAACATCACATCGGAGAAGCTGCCGTCCACTCTACGCCACCGCTGGTTCGAATTCTCAGCGACTCAACCGGCGGGAGAACCGGACCTCGTCAAGCTGTCGCGCTTCCTGCAACGCGAGGCGGACCTGTGCAGCCCATACGCACAGCCGGAGCCAGAGACGAGAGTGGAGAACACCAGCGGCCGGCGGAAGATGTTGAACACGCCTCAGAGGACGCACACCACGCCAGCGAAGGAAGAAAGGAAATGCGCAGCATGTCAGAAGCCGGGGCACATCCCACAAGATTGTCCCGAATTCAAGAGAGCAGCCGTCAGCGAGCGCTGGGATACGGCGAAGCGCGAAAATTTGTGTTTCCGGTGCCTACGGTTCCGGTCCCGGGGACACGTGTGTAAAAAGAAGAAGTGCGGCGTCGACAGCTGTGAACGCACGCACCACGAGCTGTTGCATAAGAAACCAGCATGGCAGAAGCCGAAAGAAAAAGAAGAGGCGGTCACCTCGACGTGGGCCGCAAGAAGTGCGACAGCCTACCTGAAGATGGCGCCAATTACCGTTATCGGACCGGCGGGAGAAGCAGATACATGGGCCCTGCTGGACGACGGGTCGACGATCTCGCTGATTGACGAAGACTTCGCGAGACGAGTGGGCGCCAAAGGACCGATCGAACCCCTCTTCATCACTGCCATCGGAGACAACAAGATAGACGCAACACGCTCACGACGCGTCCCGCTGAAGCTATGCGGACGCACGGGGGAACCGCAAGAACTGAACCTACGGACAGTCAACGGCTTAAAATTAACACCACAGCGACTGAACATCGAAGTCCTCGCGTCGTGCCACCACCTCACCGACCTCCGCCATCACTTCAAAACGAGCTACGCCTCGCCGAAGATACTGATCGGCCAAGACAACTGGCACCTGCTGGTGACGGAGGAGATGCGGACGGGACGACGCGATCAACCAGTGGCGTCTCGTACTCCGCTCGGGTGGGTTGTGCACGGAGCACGCCCGGGAGGCAAGAGACAGCGCGTCAGCTTCGTGGGACACGCGACGACGGTCGACACGAACATGGACGAAGCCCTCAAACAGTACTTCGCGATCGAGGGACTCACCGTCGCCGCCAAGACACCGAAGAATGACCCAGACGAGCGCGCGCTGAAGATCCTGCGAGAGACCACTCAACAGCAACCCGACGGCCGCTACGAGACCGCACTGCTGTGGCGTGAGGAGGGCCTGAAGATGCCCAACAATTTTGAAGCCGCACTGAATCGCCTGACGTCCGTAGAGAAGAAACTGGAGAAGGATCCAAATTTAAAAGAGCGCTACAAGCAACGAACAAACGCGCTGGTAGCGAAAGAATACGCCGAAGTAACTCCGTCGACGGGTACGAAGAAGCGAACCCGGTACTTGCCACACTTCGACGTAACACATCCAATGAAGCAGGAGAAGATTCGCATCGTGCACGACGCCGCTGCGAAAACTAGAGGGAAGAAGCCCGAACGACTTCCTGCTCACCGACCCGGACCTGCTGCAGTCGCTGCCCGGAGTGATGATACGCTTCAGGCAGCACGCCATCGCCGTCGCCGCGGACATCGCGGAGATGATTATACAGATAGGCGTCCGAAGCGAGGACCGCGACGCGCTCCGGTACTTGTGGAGGGAGGACCCTTCACAAGAGCCCATAGAATACCGGATGAGTACCCGGACGCCGCCGACCTCAAACTCCACACGTACGTGGACACGAACAAGTACGCCCACGACGCCGCGTTGTACTGGCGCGTGGAGACGCCCGACGGGGAGATGAGGACCTCCCTAGCCAAAGACCGAGTCGCAACCGTGAAGCTAACATCGATACCGCGTCTCGAGCTACAAACCGACGTGATGGGAAGCCGCATAGCCGCGGCCGTCACGGGGAAACACGACAGAAAACCAGACGCGAGAGTGTTCTGGACAGACAGCGCCACCGTATTGACCTGGCTACGAACGGGGTCGAGGTCGTATCGACCGTTCGTCGCTCACCGCATTGCAGCGATAGAAGAGAACAGCACTGTGGAGGAATGGCGCTGGGTCCCCACGAAGGAAAATGTCGCCGACGACGCCACTAGAGAGCTACCCGTCGGCTTTGAAAGAAACCACCGCTGGTTCATAGGCCCGGAATACCTAAGACGGCATCCGGATGATTGGCCCGTACAACGGACTGCAAGAAGAGCAGAAGAGACGGGCGAAGAGAAGTGCGCAATGCTCGCCGTGAGCAGAGAGAGCCTCGGCGAAGCGATCCCGGACCCAAGACGCTTCTCCAAGTGGGAGAAGTACCTGCGTGCAACGGGGCGAATACTACAATTCGTCAGCCTATGCCGCAGAAGTCGCGAGCGCACTCATTACAAGAGGACCAGACGGAACCCGCGTTCGGACCCGACGTGGGAGAAGAATAGAAAGAAGACGACTTCGAAGACCCCGCTGAACACACCGCGGACGCCAGAGCAAGCAATCATTCAATGGAAAACTTTAGACGCCGACACGCTTCGACGCGCCGAGACGCTCATTTGGCGACAGAGCCAGCGGGCGGCCTTCGAGGAAGAGATTTTGACGCTCCAGCGAGGGAAACAAATATCCCCAGCGAGCCGACTGCGAAACTTGTCCGTAACTTACGCGGACGGGATATTGAAAATAAACGGACGCATCGGCAACATAGAGGGAGCTGACGTCATCACCTCGCCTCTCGTGCTAGACGGATCCCGACGCGAAACGAGATTGATGATAGACTTCATCCATAGAAAGATGCACCACGCCGGAACCGAAGCTACGATCGCCGAGTGCCGACAGTCGTACTGGGTCTTACGCCTACGCCCAGTGACACGGAGCGTAATCCACAACTGTCTTCCGTGTCGTATCCGCAAGGACACTCCACCGCGTCCAGCCACAGGCGACCACCCACCGAGCAGACTGGCACACCATCGGCGACCATTTACATACGTGGGCCTCGATTACTTCGGGCCCTATCAAGTTACCACCGGCAGAAGCACCCAGAAGCACTACGTGGCCATCTTCACATGTCTCACTACGCGTGCGGTACATTTAGAACCGGCAGCGAGCCTCAGCACTGACTCAGCGGTGATGGCACTCCGGCGCATGATCGCGCGCCGGGGAGCTCCGACGGAAATATGGAGCGACAACGGCACCAACTTACGGGGTGCCGACAAGGAGCTGCGCCAAGCTTTGGACAAGGCGACCGAGCACGAAGCGAGCTTAAGACTTATCCAGTGGCGCTTCATCCCACCGGGCGCGCCTTTCATGGGCGGCGCCTGGGAAAGAATGGTACGGGCAGTAAAGACCGCGCTCTCGGCCACGGAGCAGCCGAGGCACCCGACGCCCGAAATATTTCACACTCTGCTAGCGGAGGCAGAGTTCACAGTGAACAGCCGACCTCTCACCCATGTATCGGTGAGCGCCGACGATCCCGACCCTCTAACACCGAACCACTTCCTGCTGGGAGGCCCGGCGCGAGTCCCCGTGCCGGGCAAATTTGACGACGCCGACCTCATAGGGCGCGCACACTGGCGCGCAGCACAACGTCTGGCAGATGTGTTCTGGAGTCCCTGGCTCCGGGAGTACCTGCCCGACCTGCAGAACCGGCGGGAGCCCCACAGCCGCGGGCCCGCCCTGAAGATAGGCGACGTCGTGATAATAGCAGACGGAACGCTCCCACGGAACACCTGGCCACGAGGGATCATCCAGGAGGTTTACCCGGGGGCCGACGGCATCACACGAGTGGTCGACGTGCGCACCGCCGGCGGTATCCTGCGACGCCCGGCAAAGAAGATTATCGTGCTGCCCACGATGCCCGCCGCTCACCAAGGAGGATGCAGCGACGTGAACGACGCTGCACGGCGGGAGGATGTTCGCGACGGACATAAATAA
Protein
MVLTRSEKMRSSRLDRPGNEAVSGSTSQDAQQRAVSAAPRSGVTQGPPPMAATSSQSTAPRSGVTQGPPPMAAPSSQVEKCPGVPRGSQAMPPSRQILPTQYSPASPTGPNSGVCRRVVRPPSTATPATTSGDAATESVVSASQNRKESALTANPIVHGSHITDAAAKISTTEEGSTLRDGMAPPVRGSSRKSSQQSQRLLLMARLKEEHLRAKEKQARLQAELAAARISTLEAEALVEEEEDARTTLTEDENEQTQRVDTWLSQQRSIALQGVEERVMQSTHGSPATIEQPQLELPAPIEQLKLPAPAAAPIAVPVAPKSDIAELAAAIATAARQARPGPSHRYYGELPVYSGSHQEWLSFKVAYAESADSFSAAENTARLRRTLRGRAREAVENLLLHYTEPAEIMRTLESRFGRPEAIAATELERLRALPRCTDTPRDICVFANEVNNVVAALRALDRVHYMYNPELTNITSEKLPSTLRHRWFEFSATQPAGEPDLVKLSRFLQREADLCSPYAQPEPETRVENTSGRRKMLNTPQRTHTTPAKEERKCAACQKPGHIPQDCPEFKRAAVSERWDTAKRENLCFRCLRFRSRGHVCKKKKCGVDSCERTHHELLHKKPAWQKPKEKEEAVTSTWAARSATAYLKMAPITVIGPAGEADTWALLDDGSTISLIDEDFARRVGAKGPIEPLFITAIGDNKIDATRSRRVPLKLCGRTGEPQELNLRTVNGLKLTPQRLNIEVLASCHHLTDLRHHFKTSYASPKILIGQDNWHLLVTEEMRTGRRDQPVASRTPLGWVVHGARPGGKRQRVSFVGHATTVDTNMDEALKQYFAIEGLTVAAKTPKNDPDERALKILRETTQQQPDGRYETALLWREEGLKMPNNFEAALNRLTSVEKKLEKDPNLKERYKQRTNALVAKEYAEVTPSTGTKKRTRYLPHFDVTHPMKQEKIRIVHDAAAKTRGKKPERLPAHRPGPAAVAARSDDTLQAARHRRRRGHRGDDYTDRRPKRGPRRAPVLVEGGPFTRAHRIPDEYPDAADLKLHTYVDTNKYAHDAALYWRVETPDGEMRTSLAKDRVATVKLTSIPRLELQTDVMGSRIAAAVTGKHDRKPDARVFWTDSATVLTWLRTGSRSYRPFVAHRIAAIEENSTVEEWRWVPTKENVADDATRELPVGFERNHRWFIGPEYLRRHPDDWPVQRTARRAEETGEEKCAMLAVSRESLGEAIPDPRRFSKWEKYLRATGRILQFVSLCRRSRERTHYKRTRRNPRSDPTWEKNRKKTTSKTPLNTPRTPEQAIIQWKTLDADTLRRAETLIWRQSQRAAFEEEILTLQRGKQISPASRLRNLSVTYADGILKINGRIGNIEGADVITSPLVLDGSRRETRLMIDFIHRKMHHAGTEATIAECRQSYWVLRLRPVTRSVIHNCLPCRIRKDTPPRPATGDHPPSRLAHHRRPFTYVGLDYFGPYQVTTGRSTQKHYVAIFTCLTTRAVHLEPAASLSTDSAVMALRRMIARRGAPTEIWSDNGTNLRGADKELRQALDKATEHEASLRLIQWRFIPPGAPFMGGAWERMVRAVKTALSATEQPRHPTPEIFHTLLAEAEFTVNSRPLTHVSVSADDPDPLTPNHFLLGGPARVPVPGKFDDADLIGRAHWRAAQRLADVFWSPWLREYLPDLQNRREPHSRGPALKIGDVVIIADGTLPRNTWPRGIIQEVYPGADGITRVVDVRTAGGILRRPAKKIIVLPTMPAAHQGGCSDVNDAARREDVRDGHK

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
1774
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0014
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1774
 
 

Population Genetic Test Statistics

Pi
41.637852
Theta
32.830796
Tajima's D
-0.658641
CLR
177.936572
CSRT
0.205389730513474
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号